ID: 1147402823

View in Genome Browser
Species Human (GRCh38)
Location 17:40191339-40191361
Sequence CCCGGCGGCCGCGCTCCCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 6, 3: 39, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147402823_1147402830 19 Left 1147402823 17:40191339-40191361 CCACGGGGAGCGCGGCCGCCGGG 0: 1
1: 0
2: 6
3: 39
4: 298
Right 1147402830 17:40191381-40191403 GCTGCTGCAGCGCTGCAGCGAGG 0: 1
1: 0
2: 1
3: 37
4: 241
1147402823_1147402827 -8 Left 1147402823 17:40191339-40191361 CCACGGGGAGCGCGGCCGCCGGG 0: 1
1: 0
2: 6
3: 39
4: 298
Right 1147402827 17:40191354-40191376 CCGCCGGGAGACGGCCAACTTGG 0: 1
1: 0
2: 0
3: 3
4: 31
1147402823_1147402831 30 Left 1147402823 17:40191339-40191361 CCACGGGGAGCGCGGCCGCCGGG 0: 1
1: 0
2: 6
3: 39
4: 298
Right 1147402831 17:40191392-40191414 GCTGCAGCGAGGTCACGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147402823 Original CRISPR CCCGGCGGCCGCGCTCCCCG TGG (reversed) Exonic