ID: 1147403398

View in Genome Browser
Species Human (GRCh38)
Location 17:40194194-40194216
Sequence TGGGGGTCCCAGCCCTGACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 365}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147403398 Original CRISPR TGGGGGTCCCAGCCCTGACC AGG (reversed) Exonic
900182652 1:1319104-1319126 TGCGGGTCCCAGACCAGACTGGG - Intronic
900203305 1:1420724-1420746 TGGGGGTCCCAGCACTGGGTGGG - Intronic
900411586 1:2514970-2514992 GAGGAGTCCCAGCCCTGCCCAGG - Intronic
900538235 1:3189471-3189493 GGGTTGTCCCAGGCCTGACCTGG - Intronic
901783642 1:11610489-11610511 TGGGGGTCCCTGCAGGGACCAGG - Intergenic
902331121 1:15731712-15731734 TGGGGCTCCCAGACCTCTCCTGG + Intronic
903101524 1:21034996-21035018 TGGGGCTCCAGGCCCTCACCGGG - Intronic
904276143 1:29385546-29385568 TGGAGTTCCCAGCCTTGACAGGG + Intergenic
904855048 1:33491479-33491501 TGGCTGTCCGAGCCCTGACCAGG - Exonic
904953465 1:34263129-34263151 TGGGGGTAGCTGCACTGACCTGG + Intergenic
905202145 1:36322587-36322609 CGGGGGTCCCGGCGCTGAGCCGG + Exonic
905259873 1:36709673-36709695 TGGGTTTCACAGCCCTGAGCTGG - Intergenic
905767443 1:40612920-40612942 TGGGTTTCCCAGCCCAAACCTGG - Intergenic
905827766 1:41039400-41039422 GGGGGGTCCTAGTCCTGACAAGG + Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
907912821 1:58841615-58841637 TGGGGTTCCCTGGCCTGCCCTGG - Intergenic
909616390 1:77614399-77614421 TGGGGGTCTTAGCCCTTAGCTGG - Intronic
911267030 1:95754389-95754411 AGGGTGTCACAGCCCTGACTGGG - Intergenic
915016430 1:152738146-152738168 TATGGGGCCCAGCCCTGTCCTGG + Intronic
915087417 1:153397898-153397920 TGGGGGTCACAGCCCCGCCTGGG - Intergenic
915185022 1:154098254-154098276 TGGGAGTCACAGCCCTGGCTTGG + Intronic
918053061 1:180991324-180991346 TGGGTGGCTCTGCCCTGACCTGG + Intronic
918396045 1:184114094-184114116 AGAGGGTCCTGGCCCTGACCAGG - Intergenic
920373333 1:205493133-205493155 TGTGGGTCCCAGCCCCTCCCAGG + Intergenic
922721880 1:227903690-227903712 TGGGGGACACAGCCCTGCCTTGG + Intergenic
922722032 1:227904223-227904245 TGGGACCCCCAGCCCTGCCCTGG + Intergenic
922789922 1:228305877-228305899 TGGGGGACACGGCCCTGTCCTGG + Intronic
1062958273 10:1554287-1554309 TGGGGCTCCCAGTCCTTCCCTGG + Intronic
1063133034 10:3194921-3194943 AGGGGGCCCCAGCCCAGCCCAGG - Intergenic
1063135528 10:3213319-3213341 TGAGGCTCCGAGCCCTGACCTGG - Intergenic
1067836364 10:49644120-49644142 TGGCAGTACCAGCCCTGCCCTGG - Intronic
1068958453 10:62843242-62843264 TGGGGTTCCCACCCCTGAAGAGG + Intronic
1070428860 10:76316189-76316211 AGGGCGTCACAGCCCTGACTTGG - Intronic
1070604511 10:77889357-77889379 TGGGCCTCCCAGCTCTGAGCTGG + Intronic
1070776094 10:79110757-79110779 TGGGGGCCTCAGTCCTCACCTGG - Intronic
1075342135 10:121655614-121655636 TGGCGGTCACAGCACTGGCCTGG - Intergenic
1075604243 10:123792896-123792918 TGTGGGTCCCAGCTCTGCTCTGG - Intronic
1075635535 10:124027803-124027825 TTTGGGTCCCAGCCCTGCCCTGG - Intronic
1076505607 10:130970902-130970924 TAGGGGTTCCAGCCCTGGTCAGG - Intergenic
1076608121 10:131702563-131702585 GGTGGTTCCCAGCCCTGGCCGGG - Intergenic
1076806570 10:132862050-132862072 TGGCGGTCACAGCCATGCCCAGG - Intronic
1076848680 10:133082428-133082450 TGGGGGCCCCAGGCCACACCGGG + Intronic
1076869400 10:133186038-133186060 CGGGGACCCCAGCACTGACCCGG + Exonic
1076941501 10:133613070-133613092 GCAGGGTCCCAGCCCTGGCCTGG - Intergenic
1077056337 11:595638-595660 TGGGGGACACAGGCCTGGCCTGG + Intronic
1077101984 11:826400-826422 TCTGGGGCCCAGCCCTGACTGGG - Intronic
1077181815 11:1220300-1220322 TGAGGGTCCCAGCTCTGCCATGG + Intergenic
1077351292 11:2094398-2094420 TGGGCGGCACAGCCCTGAGCTGG + Intergenic
1077356885 11:2122809-2122831 TGTGGGTGCCAGCCCTGGCCTGG + Intergenic
1077912795 11:6587515-6587537 AGGGGGTCACAGCCCTGGCTTGG - Intronic
1078415698 11:11162859-11162881 TGGGGGTGCCAGACAAGACCTGG + Intergenic
1079082672 11:17424773-17424795 TGGGGGCCCCAGCAGTGACCAGG + Intronic
1082026916 11:47579135-47579157 TGGGGGCCTCGGCGCTGACCAGG + Exonic
1082833864 11:57638512-57638534 TGGGGATCCAAGCCCGGCCCGGG + Intergenic
1083179733 11:60977411-60977433 TGGGGATCCCAGCCCTACCAGGG - Intronic
1083304002 11:61753435-61753457 GGGGGGTCCCAGCCCCAAACAGG - Intronic
1084399770 11:68936846-68936868 TGGGGGTCCCAGGGCTGCTCGGG - Exonic
1084426770 11:69088305-69088327 TGGGGACCACAGGCCTGACCAGG + Exonic
1085048014 11:73364448-73364470 TGGGGGTCCCAGAAATGGCCTGG - Exonic
1087266857 11:96070429-96070451 AGGGAGTCCCAGCCCTGGCTTGG - Intronic
1087836228 11:102878061-102878083 TGGGGGTCCCAGCAAAGACATGG - Intergenic
1088513383 11:110600269-110600291 TGGGAGTCACAGCCCTGCTCAGG - Intronic
1089314624 11:117583163-117583185 AGAGGGTCCCAGACCTGTCCAGG - Intronic
1089493504 11:118897524-118897546 TGGGGGTCTCAGCCCTGCTAGGG + Exonic
1094057267 12:26280008-26280030 TGGAGGTTTCTGCCCTGACCTGG - Intronic
1094281768 12:28747902-28747924 TGGGGGTTCCTGCCCTCATCTGG + Intergenic
1095360883 12:41337389-41337411 TTAGGGTCACAGCTCTGACCTGG - Intronic
1096258831 12:50078574-50078596 TCGGAGCCCCAGGCCTGACCTGG - Exonic
1101255691 12:102974421-102974443 TGTGGGTCCCACCCATGAGCTGG + Intergenic
1101965022 12:109276643-109276665 TGTGGCTCCCAGCCCTTTCCTGG + Intergenic
1102254452 12:111407479-111407501 TGGGTTTCCCATCACTGACCTGG + Intronic
1102766807 12:115440557-115440579 TCGGGGGCCCAGGCTTGACCAGG - Intergenic
1103559914 12:121788297-121788319 TACTTGTCCCAGCCCTGACCAGG + Intronic
1104723447 12:131060109-131060131 TGCGGCACCCAGCCCTCACCAGG - Intronic
1104903244 12:132200235-132200257 CGAGCGTCCCAGCCCTGAGCTGG - Intronic
1105344753 13:19561726-19561748 TCGGAGGCCCAACCCTGACCCGG + Intergenic
1105535288 13:21259841-21259863 TAGGAGGCCCAACCCTGACCCGG - Intergenic
1105943179 13:25169645-25169667 TGGTGGTCCCAGCCAAGCCCCGG + Exonic
1106480523 13:30133798-30133820 TGGGGCTCCCAGCTCTGGCCCGG - Intergenic
1108063456 13:46554087-46554109 TGGAGTTCCCAGCCCTGCGCGGG - Intronic
1108508852 13:51136744-51136766 TGGGGGTCCTGGCCCTGGGCGGG - Intergenic
1109886567 13:68552945-68552967 TGGGGGCCCCACCCCTTGCCAGG + Intergenic
1112173117 13:96994223-96994245 TAGGGGACCCTGCCCTGACCCGG - Intronic
1112692944 13:101916787-101916809 AGGGGGGCTCAGTCCTGACCGGG + Intronic
1113432370 13:110261955-110261977 GGTGGGTCCCAGCTGTGACCGGG + Intronic
1113919907 13:113901442-113901464 TGGCGGTCCCAGCCTTGGCAAGG - Intergenic
1114349486 14:21835029-21835051 GGGGGGTCATAGCCCTGACTTGG + Intergenic
1114635894 14:24186586-24186608 TGGGGGTTCAAGCCTTGGCCTGG - Intronic
1116143866 14:41037900-41037922 TGGGAGTCCCATCCATGGCCTGG - Intergenic
1118085003 14:62404441-62404463 TGGTGGTCCATTCCCTGACCTGG + Intergenic
1118157901 14:63258621-63258643 TGAGGGTACCAGCCATGCCCTGG + Intronic
1119645740 14:76347006-76347028 TCTGGGTCCCAGCCTTGGCCTGG - Intronic
1119678586 14:76574893-76574915 TGGGGTTCCCAGCCCCGGCGGGG + Intergenic
1119770898 14:77220114-77220136 TGGGAGTCCCAGCACTGGGCAGG + Intronic
1121527952 14:94632589-94632611 AGGGTGTCACAGCCCTGACTTGG + Intergenic
1122278752 14:100609346-100609368 TGGGGGTCCCAGCCCTGAAGGGG + Intergenic
1122505814 14:102231083-102231105 TTGGGGTGCCAGCCCAGAACTGG + Intronic
1122956822 14:105075070-105075092 TGTGGGTCCCCGCCCAGACCTGG - Intergenic
1123458229 15:20444718-20444740 GGAGGGTGCCTGCCCTGACCTGG + Intergenic
1123472465 15:20565364-20565386 TGGGGCACCCAGGCCTCACCTGG + Intergenic
1123645539 15:22434989-22435011 TGGGGCACCCAGGCCTCACCTGG - Intergenic
1123732771 15:23160355-23160377 TGGGGCGCCCAGGCCTCACCTGG + Intergenic
1123750904 15:23357735-23357757 TGGGGCGCCCAGGCCTCACCTGG + Intronic
1124283275 15:28381651-28381673 TGGGGCGCCCAGGCCTCACCTGG + Intronic
1124299424 15:28529962-28529984 TGGGGCGCCCAGGCCTCACCTGG - Intronic
1124409471 15:29424251-29424273 TGGGGCTCCCACCGCTGACTGGG + Intronic
1124563366 15:30794743-30794765 TGGGGTGCCCAGGCCTCACCTGG + Intergenic
1124959917 15:34386487-34386509 TGGGGCGCCCAGGCCTCACCTGG - Intronic
1124976544 15:34532708-34532730 TGGGGCGCCCAGGCCTCACCTGG - Intronic
1129162206 15:73753120-73753142 AGGGAGGCCCAGCCCCGACCCGG - Intergenic
1129188992 15:73926871-73926893 GCGGGGTCCGAGCCCTGCCCGGG - Exonic
1129394947 15:75238563-75238585 TGGGTGTCAGGGCCCTGACCAGG - Intergenic
1129718456 15:77865093-77865115 TGGGCTTCCCTGCCCTGAACAGG - Intergenic
1130406646 15:83608853-83608875 TTGGGGTCCCATTCCTGACTGGG + Intronic
1130421268 15:83749277-83749299 TGAGGGTCACATCCCTGGCCAGG - Intronic
1130460466 15:84155773-84155795 TGGGCTTCCCTGCCCTGAGCAGG + Intergenic
1132305409 15:100808274-100808296 AGGGAGTCACAGCCCTGGCCTGG - Intergenic
1132506143 16:310056-310078 GGGGGATCCCATCCCTGTCCAGG + Exonic
1132828784 16:1917752-1917774 TGGGGGCCCCAGGCTTGACCTGG - Intronic
1132865880 16:2092508-2092530 TGGGGGCCCCAGCTCTGGGCTGG + Exonic
1133002654 16:2858832-2858854 TGGGAGTCCCAGCCCTTCCCGGG - Intergenic
1133045555 16:3086673-3086695 TTGCGGCCCCAGCCCTGCCCGGG - Intergenic
1134078346 16:11308054-11308076 AGGGAGTCCCAGTCCTGACTTGG + Intronic
1134664749 16:16010832-16010854 CTGGGGTCCCACCCCTGACTCGG - Intronic
1134835351 16:17356422-17356444 CGGGGGCCCCAGGGCTGACCAGG - Intronic
1135521743 16:23183060-23183082 TGGGGGTCCCGGGCCACACCTGG + Intronic
1136355829 16:29744476-29744498 TGGGGGCCCCAGCCCTGGGAGGG - Exonic
1137891728 16:52170073-52170095 ATGGGGTCCCAGATCTGACCGGG + Intergenic
1137897854 16:52233375-52233397 TCAGGGTCACAGACCTGACCAGG + Intergenic
1138528429 16:57621866-57621888 TAGGGGTCCCAGCCTTGGCATGG - Intronic
1138574916 16:57901422-57901444 TGCCGGTCACAGCCCTGTCCCGG + Exonic
1139679768 16:68552448-68552470 AGGGGGACACAGCCCAGACCTGG + Intronic
1140891885 16:79291829-79291851 TTGTGGTCCCAGCCCTCACAGGG + Intergenic
1140899903 16:79357916-79357938 TGGCAGTCCCAGCCCGGATCAGG - Intergenic
1141178994 16:81739562-81739584 AAGGGGTCCCAGCCCTTCCCTGG - Intronic
1141427015 16:83951251-83951273 TGGTGGCCACAGCCCTGCCCTGG - Exonic
1141464137 16:84195601-84195623 TGGGGGTCCGGGCCCTGGCTGGG - Exonic
1141646155 16:85369066-85369088 TGGAGGTCAGAGCCCTGACTCGG + Intergenic
1141935849 16:87237220-87237242 TGGGGGTCCCTCCCCTGCCCGGG - Intronic
1142006343 16:87691169-87691191 TGGGGGTCCCAGGCTAGACTCGG + Intronic
1142347599 16:89563987-89564009 TGGGGATGCCAGCTCAGACCAGG - Exonic
1142566107 17:841343-841365 TCTGGGTCCCAGCCCTGGCAGGG - Intronic
1142863582 17:2777507-2777529 TGGGGGTGCCGGCCCTGAGTGGG + Intronic
1142904805 17:3034490-3034512 TGGGGGGCCCAGCCTGGCCCTGG + Exonic
1143118978 17:4595712-4595734 TGGGGCTCCCAGCTCTGGCCAGG - Intronic
1143184724 17:5003360-5003382 AGGGGATCCAAGCCCTGTCCTGG - Intronic
1143275653 17:5707717-5707739 TCTGGGTCCAAGCCCTGGCCTGG + Intergenic
1143651269 17:8265465-8265487 TGGGGCTCCCACACCTCACCAGG - Exonic
1143764687 17:9129823-9129845 TGGTGGTCCCAGACCTGGCAAGG + Intronic
1143837089 17:9701255-9701277 TGGGGGTCCATGCCCCGGCCGGG + Intronic
1144673732 17:17147549-17147571 TGGGTTTCCCAGTCCCGACCTGG + Intronic
1146586940 17:34090741-34090763 TTGGGGTCCCAGCCCAGAATGGG - Intronic
1146946120 17:36874828-36874850 TGGGCCTCCCAGCCAGGACCTGG + Intergenic
1147376222 17:40023766-40023788 TGGGGGTCCCCGCCCAGCCCTGG + Intronic
1147403398 17:40194194-40194216 TGGGGGTCCCAGCCCTGACCAGG - Exonic
1147660297 17:42113619-42113641 TTTGGGCCGCAGCCCTGACCTGG - Exonic
1148808729 17:50277533-50277555 TTGGGCTCCAAGCACTGACCTGG + Intronic
1149772192 17:59331321-59331343 TGGGAATCCCAGCCCTGCCCTGG + Intergenic
1150002805 17:61452147-61452169 CGGGGCTCCCAGCCCCTACCCGG + Intergenic
1151415167 17:73957308-73957330 TGGAGGGCCCAGCGCTGAGCTGG - Intergenic
1152549551 17:81022675-81022697 TGGTGGTCCCTTCCCTGCCCTGG - Intergenic
1152565550 17:81098821-81098843 AGGCGGTCCCCACCCTGACCCGG - Intronic
1152610292 17:81311964-81311986 TGGGGGCCCCAGCCCCGAACAGG + Exonic
1152701568 17:81822335-81822357 TGGGGTTTCCAGCCCTGCCCGGG + Intergenic
1152784661 17:82241521-82241543 TGGGGTTCCCTGCCCTGAGAGGG - Intronic
1157569538 18:48703387-48703409 TGGGGATCCTAGCCCAGGCCAGG - Intronic
1157804785 18:50649974-50649996 CTGGGGCCCCAGCCCTGATCTGG + Intronic
1157912045 18:51625416-51625438 TGGTGGTCCCAGCATTAACCAGG - Intergenic
1158159289 18:54461962-54461984 TGGGGAACACAGCCCTGAGCGGG - Intergenic
1159849852 18:73514820-73514842 TGGGTGTCACAGCCCTGGCTTGG + Intergenic
1160025079 18:75209687-75209709 AGGGGCTCCCCGCCCTGCCCGGG - Intergenic
1160034439 18:75287402-75287424 TGGGGGACGCAGCCTTGGCCAGG - Exonic
1160392847 18:78548040-78548062 CGGGGGCCCCAGCTCTGCCCAGG + Intergenic
1160500688 18:79400073-79400095 TGGGGGTCCCGGCCCGGCGCAGG - Intronic
1160564718 18:79779970-79779992 TGGGCGGGCCCGCCCTGACCTGG + Intergenic
1160659602 19:291778-291800 CCGGAGTCCCGGCCCTGACCCGG + Intergenic
1160833991 19:1116195-1116217 TGGGGGTCCCGGACAGGACCGGG + Intronic
1160987490 19:1845895-1845917 TGGAGGCTCCAGCCCTGCCCTGG + Intronic
1161222304 19:3123286-3123308 TGGCGGTCCCAGCCCGGCTCTGG - Exonic
1161301245 19:3544130-3544152 TGGGCATCTCAGCCCTGCCCTGG - Intronic
1161495535 19:4584100-4584122 TGGCTGTCTGAGCCCTGACCTGG + Intergenic
1161550451 19:4909674-4909696 TCGGGGTGCCAGCCCGGGCCGGG + Intronic
1162004208 19:7766818-7766840 TGGGGGTCCTCGTCCTGGCCTGG + Intronic
1162145923 19:8611924-8611946 TGGGGGTCACCGCCCTTCCCTGG - Intergenic
1162332579 19:10039224-10039246 TCGGGCTCCCAGACCTGACAAGG - Intergenic
1162749154 19:12817809-12817831 TGGGGGACCCAGCTCTGATCTGG + Intronic
1163157909 19:15449343-15449365 TGGGGGTCCCTACCCAGGCCCGG + Intronic
1163613433 19:18312358-18312380 TGTTGGTGCCACCCCTGACCTGG - Intronic
1164324270 19:24178498-24178520 TGGGGGTGCCAGCCGTGAGGTGG - Intergenic
1164692529 19:30222178-30222200 AAGGGGTTCCAGCCCTGGCCAGG + Intergenic
1165247591 19:34506025-34506047 TGGGAGTCCCAGCCCGTCCCTGG + Exonic
1165309873 19:35023401-35023423 TGGGGATGCCAGGCCTGAGCAGG - Intronic
1165507909 19:36245935-36245957 TTGGGGTCCCCGCCCAGACCCGG - Intronic
1165895016 19:39136277-39136299 GGAGGGTTCCTGCCCTGACCAGG - Intronic
1166360538 19:42251265-42251287 TGGAGGGCCCAGCCCAGGCCTGG + Intronic
1166732665 19:45067740-45067762 AGGGGGACACAGCCCTGGCCTGG + Intronic
1167444272 19:49528223-49528245 GGGGGGTCCCAGACCTGCCAGGG - Intronic
1168126589 19:54286727-54286749 CGGGGGTTCCAGCTCTGCCCAGG + Intergenic
1168149434 19:54436760-54436782 AGGATGTCCCAGCCCTGGCCAGG - Intronic
1168175301 19:54624136-54624158 CGGGGGTTCCAGCTCTGCCCAGG - Intronic
1168336931 19:55602285-55602307 TGGGGGCTCCTGCCCTGACTTGG - Exonic
925237175 2:2289996-2290018 TGGGGATCCCAGCCCTGCTATGG - Intronic
925461700 2:4068792-4068814 TGTGGCTTCCAGCCCTGACCAGG - Intergenic
925462097 2:4072465-4072487 TGTGGCTTCCAGCCCTGGCCAGG - Intergenic
925732116 2:6926612-6926634 TGGGAATCCCAGTCCTGTCCTGG + Intronic
926125604 2:10270029-10270051 TGGGACTCACAGCCCTGGCCTGG - Intergenic
926131259 2:10304213-10304235 TGGGGGTCCCTCTCCTGGCCGGG + Intronic
926134900 2:10329727-10329749 CGTGGATCCCAGCCCTGCCCAGG + Intronic
926424033 2:12725260-12725282 TGGGGGTCCTATCCCTGAATAGG - Intronic
927574402 2:24189556-24189578 TGGTGGTCCCAGCACTTAGCTGG + Intronic
928116449 2:28548491-28548513 TTGGAGTCCCAGCTCTGTCCTGG + Intronic
928364697 2:30691920-30691942 TGGGGGCTCCAGCCTTGAACAGG + Intergenic
929014655 2:37482230-37482252 AGGGAGTCACAGCCCTGGCCTGG - Intergenic
931463000 2:62464288-62464310 TGGGGGTCACAGCCCCCATCTGG + Intergenic
931671917 2:64654536-64654558 TGGGGGCTCCAGCCGTGAGCCGG + Intronic
931956280 2:67429195-67429217 GGTGGGAACCAGCCCTGACCAGG - Intergenic
933724325 2:85418176-85418198 TGGGAGACCCAGCCCAGGCCTGG - Intronic
935579728 2:104746127-104746149 TGGGGGCCCCGTCCCTTACCAGG - Intergenic
936462333 2:112722637-112722659 TGAGGGTCCCAGCTCTGTCCTGG + Intronic
936484514 2:112914755-112914777 AGGAGATCCCAGCCCTGACAAGG - Intronic
936896540 2:117434215-117434237 TTGGTGGTCCAGCCCTGACCTGG + Intergenic
937356116 2:121199190-121199212 TGGGGGTTCCATGCCTGCCCTGG - Intergenic
938068030 2:128292388-128292410 TGGGCGTCCCTGCCCTGAGAAGG - Intronic
938970926 2:136431772-136431794 AGGGTGTCCCAGCCCTGAGCAGG + Intergenic
940449549 2:153819495-153819517 TGCAGGTACCAGCCCTGACAAGG - Intergenic
943426915 2:187749381-187749403 AGGGTGTCACAGCCCTGACTTGG + Intergenic
946208827 2:218130834-218130856 TGGAGGTCACTGGCCTGACCTGG + Intronic
946321961 2:218959715-218959737 TGGGGGGCCTAGCCCCGGCCCGG - Exonic
946412522 2:219522412-219522434 AGGGGTTCCCAGCCCTCCCCGGG - Intronic
946966308 2:225041752-225041774 GGGGGGCCCCAGCTCTAACCAGG + Intronic
947742157 2:232489590-232489612 GGGGGGTCCCAGAGCTGACCCGG - Intergenic
948213536 2:236212255-236212277 TGGGGATCCCATCCCAGAACAGG + Intronic
948686625 2:239674492-239674514 TGGGGGTCCCATCTCTGGGCTGG + Intergenic
949045797 2:241872179-241872201 TGTGGGTACCAGCAATGACCAGG + Exonic
1168955631 20:1832488-1832510 CAGGGGGCCCAGCCCTGGCCTGG - Intergenic
1169870158 20:10240950-10240972 TGGGGGTCCCTGACATGAGCTGG + Intronic
1172363983 20:34334893-34334915 TGGGTGACCCAGGCCTGCCCTGG + Intergenic
1175280844 20:57803288-57803310 TGGGGGCTCCGGCCCAGACCTGG + Intergenic
1175312794 20:58023676-58023698 AGGGTGTCACAGCCCTGGCCCGG + Intergenic
1175963712 20:62649687-62649709 TGGCTGTCCCATCCCTGCCCCGG + Intronic
1175999611 20:62826013-62826035 TGGGGGTCCCACCTCTGCCAAGG + Intronic
1176095811 20:63343859-63343881 CGGGGGTCACAGCCCTGGCAAGG + Intronic
1176114961 20:63428175-63428197 TGGGGGTGGGAGCCCAGACCAGG + Intronic
1176370530 21:6059402-6059424 TGGGGGTCTCAGCCTGGGCCAGG - Intergenic
1176973186 21:15289583-15289605 AGGGTGTCACAGCCCTGGCCTGG + Intergenic
1178707509 21:34888134-34888156 TGGGTGACTCAGCCCTGACTCGG + Intronic
1178944123 21:36932051-36932073 TGGGGGAGTCAGCCCTGGCCAGG - Intronic
1179270287 21:39845377-39845399 TGTGGATCCCATCCCTGGCCTGG - Intergenic
1179436224 21:41363953-41363975 TGGGGGCCCCAGCCCAGGGCTGG - Intronic
1179752989 21:43479139-43479161 TGGGGGTCTCAGCCTGGGCCAGG + Intergenic
1180079360 21:45479858-45479880 TGGTGGTGCCTTCCCTGACCGGG + Intronic
1180080123 21:45482865-45482887 TGGGGGTCCGAGCACTGAGTGGG - Intronic
1180086711 21:45510860-45510882 TGGGGGAGCCAGGCCTGGCCAGG - Intronic
1180089242 21:45525313-45525335 TGAGGGTCCCAGCCAAGGCCGGG - Intronic
1180593596 22:16960093-16960115 TTGGGGTCTCAGTCCTGGCCAGG + Intergenic
1181501044 22:23315693-23315715 TGGGGCTCCCAGACCTGGGCGGG - Exonic
1181562676 22:23714883-23714905 TGGGGGTCCTTGCCCTGCCCTGG - Intergenic
1181747515 22:24966163-24966185 TGGGAGCCTCAGCCCTGACCTGG - Intronic
1182294963 22:29307150-29307172 TGGGGGTCTCCGCGCTCACCTGG - Exonic
1182300977 22:29336898-29336920 TGTGGGTGCCAGCCCTTGCCAGG - Intronic
1182517114 22:30865173-30865195 GAGGGGTCCCAGCCCTGAGGGGG + Intronic
1182749398 22:32629489-32629511 TGGCTGTCCCAGGGCTGACCCGG - Intronic
1183213229 22:36463823-36463845 CGGGGACCCCAGCCCTGGCCAGG + Intergenic
1183248244 22:36710296-36710318 TGGGGGTGACAGTCCTGTCCTGG - Intergenic
1183614723 22:38937036-38937058 AGGGTGTCCCAGCCCTCTCCAGG + Intergenic
1183648502 22:39140534-39140556 TGGAGGTGGCAGCCCTGGCCAGG + Intronic
1183952548 22:41359692-41359714 TGGGGGCTCCAGCTCTGGCCAGG - Exonic
1184017909 22:41799994-41800016 TGGGGAGCTCAGCCCAGACCGGG + Intergenic
1185344718 22:50306239-50306261 TGGGGGGCCCACCTCTGTCCCGG - Intronic
949331621 3:2929941-2929963 TGGGGATCCCTGCCCTGGCATGG - Intronic
950194297 3:10998419-10998441 GGGGGGTCCCAGCAGTAACCAGG + Intronic
950313588 3:11980288-11980310 TGTGGGTCCCCACCCCGACCTGG + Intergenic
950469738 3:13177281-13177303 CTGGGGTCCCAGCTCTGAGCAGG - Intergenic
950743043 3:15064924-15064946 TGGGGGTAACAGCGCCGACCTGG + Intronic
952209910 3:31219909-31219931 AGGGGGTCCCTGCCCTGAAGGGG + Intergenic
952919355 3:38274517-38274539 AAGGGGGCCCAGCCCTGTCCTGG - Intronic
953883384 3:46702700-46702722 GGGGGGACACAGCCCTGAACTGG + Intronic
953913774 3:46905563-46905585 TGGGGGTGACAGCCCTGTCTTGG - Intergenic
954304701 3:49719457-49719479 TGGTGGTCGCCGCCATGACCTGG - Exonic
954626211 3:52023379-52023401 TGGTGGTCAGAGCCCTGGCCAGG - Intergenic
954671586 3:52294009-52294031 TGGGGGTCCCAGCACTGGGATGG + Intergenic
954745908 3:52787465-52787487 TGGGGGTCTCAGCCCTCCCCTGG - Intronic
956095986 3:65716746-65716768 TGGAGGACCCATCACTGACCAGG + Intronic
960671433 3:120158418-120158440 TGGAGGACGCAGCCCTCACCAGG + Intergenic
961726201 3:128932654-128932676 TGGGGTTCCCAGGCCTCACCTGG - Intronic
962105080 3:132381760-132381782 TGGGAGTCACAGCCCTGGCTCGG + Intergenic
962437427 3:135380012-135380034 TGGGGTTGCCAGCCCTCACTGGG + Intergenic
966812113 3:183856064-183856086 AGGGGTTCCCAGCCCTGGGCAGG - Intronic
966840235 3:184082059-184082081 AGGGAGTCCCAGCCCTGGCTTGG - Intergenic
967732402 3:192918100-192918122 TGCGCGTCCCTGCCCTGCCCTGG + Exonic
968599797 4:1503570-1503592 GGGTGGTCCCCGCCCTGCCCGGG - Intergenic
968685874 4:1958273-1958295 TTGGGGTGACAGTCCTGACCGGG + Intronic
968746136 4:2361575-2361597 TGGGGCTCCAAGCCCTGCACAGG + Intronic
968980704 4:3847943-3847965 AGGGTGTCACAGCCCTGGCCTGG + Intergenic
969424677 4:7117257-7117279 TTGGAGTTCCAGCCCTCACCTGG + Intergenic
969428015 4:7137290-7137312 TGGGGGTCTCAGCCCTCCGCAGG - Intergenic
969429823 4:7147643-7147665 TGGGGGGCCCAGGCCTGGGCAGG - Intergenic
969430267 4:7149845-7149867 TGAGAATCCCAGCCCTAACCTGG - Intergenic
969466724 4:7361692-7361714 TGGGGTCCCCAGCCCTTCCCCGG - Intronic
969488436 4:7485444-7485466 TGTGGGCCCCACCCCTCACCTGG + Intronic
972075389 4:35079994-35080016 AGGGTGTCACAGCCCTGGCCTGG - Intergenic
973536861 4:51891873-51891895 TGGGGGTCCCTGCCCTTCCCAGG + Intronic
973627638 4:52789234-52789256 TGGGGCTTCCAGCCCTGGCCAGG - Intergenic
975321409 4:73012669-73012691 AGGGAGTCACAGCCCTGACTTGG - Intergenic
975984357 4:80189115-80189137 CGGGCTTCCCAGCGCTGACCAGG - Intronic
976511031 4:85910224-85910246 AGGGAGTCACAGCCCTGGCCTGG + Intronic
979056443 4:116000462-116000484 TGGAGGTTCCAGTCCTGATCAGG - Intergenic
985492279 5:186901-186923 TGGGGGTCCCAGTACTGAGGTGG - Exonic
985815319 5:2124121-2124143 TGGGGGTCCCAGGGCTCACAGGG + Intergenic
986151157 5:5131462-5131484 AGGGGGTGCCAGCTCTGTCCTGG + Intergenic
986427837 5:7652133-7652155 TGAGAGTTCCAGCCCTGAGCAGG + Intronic
989372342 5:40722815-40722837 TGGGGGGCGCAGCCCCCACCCGG + Intronic
990413404 5:55563356-55563378 TGGGGCTCTGAGCCCTGATCTGG + Intergenic
993879744 5:93348332-93348354 TGTGGGAGCCAGCCCTGCCCTGG + Intergenic
997304211 5:132826219-132826241 AGGCTGTCCCAGCCCTCACCCGG - Intronic
999244831 5:150148544-150148566 CGGGGCTCCCATCCCTGCCCTGG - Intronic
999248491 5:150167767-150167789 GGGGAGACCCAGCCCTGGCCAGG - Intronic
999250327 5:150178579-150178601 TGGGAGTTCCAGCCCAGAGCTGG + Intronic
999864324 5:155684327-155684349 TGGGGGACCCACCCCTGATCTGG - Intergenic
1001419562 5:171576352-171576374 TAGAGGTGCCAGCACTGACCCGG - Intergenic
1002052133 5:176577165-176577187 TGTGGGTCCCAGACCTGGGCTGG - Intronic
1002474526 5:179456421-179456443 TAGCAGTCCCAGCACTGACCAGG + Intergenic
1002896741 6:1384046-1384068 TGGAGGTCCCAACCCAGCCCGGG - Intergenic
1006370941 6:33643246-33643268 TGGGAGTCCCAGCAATGGCCAGG - Intronic
1006403753 6:33832558-33832580 TGGGGGGGTCAGCCCCGACCCGG - Intergenic
1006949247 6:37808010-37808032 TGGAGGTCCCAATCCTGCCCTGG + Intergenic
1007951596 6:45877461-45877483 TGTGAGTCCCAGCCCTGATCTGG + Intergenic
1010229430 6:73521585-73521607 TGCGGGTCTCAGCCCAGCCCGGG + Intronic
1013586171 6:111581085-111581107 AGTGGGTCCCAGCCAGGACCAGG + Intronic
1016923278 6:149317253-149317275 AGGGGGTCCCAGCCCTCCCCGGG + Intronic
1017714581 6:157200158-157200180 TGGGGGAGCCACACCTGACCAGG + Intronic
1017917242 6:158840931-158840953 TGGGGGTCCCCACCCTGAAGTGG - Intergenic
1019270345 7:143627-143649 AGGGGGTCCCAGCCCTGCCAGGG + Intergenic
1019344450 7:522552-522574 TGGGCGTCCCCGCCCAGGCCCGG + Intergenic
1019703848 7:2488159-2488181 TGGGGGCCCCATCCCTGCCGAGG - Intergenic
1019724631 7:2594650-2594672 TGGGGCTTCCAGCCCAGAGCAGG + Intronic
1020066776 7:5194271-5194293 TGTGGCTGCCAGCCCAGACCTGG - Intronic
1020277957 7:6636441-6636463 TGGGGACCCCAGGCCTGACTGGG - Intergenic
1023834120 7:44058547-44058569 TTGAGGGCCCAGCCCAGACCTGG + Intronic
1024064055 7:45718417-45718439 TGGGGCCCCCAGGCCTGAACAGG - Exonic
1024245905 7:47470564-47470586 TGGTGCGTCCAGCCCTGACCTGG + Intronic
1025230648 7:57201519-57201541 TGGGGTGCCCAGCCTTGTCCTGG - Intergenic
1025255315 7:57380895-57380917 TTGGTGTCCCAGCCCTTCCCGGG - Intergenic
1025730343 7:64102237-64102259 TGGGGGGCCCTGCCCTGCCCTGG + Intronic
1026674431 7:72417111-72417133 GGGCGGTCCCAGCCGTGATCTGG + Intronic
1026828029 7:73596123-73596145 TGGGGGTGCCAGCCTGGGCCCGG + Intronic
1026890507 7:73979038-73979060 TGGGGGCACAAACCCTGACCTGG + Intergenic
1029422311 7:100477882-100477904 TGGGGAGCCCAGCCCCGATCCGG - Exonic
1034200712 7:149281629-149281651 TGGGGGCCCCAGCCGTCATCAGG + Exonic
1034530464 7:151693245-151693267 TGCGGGTCTCAGGCCTGCCCTGG - Intronic
1035253611 7:157612888-157612910 TGGGGGGCCCTGCCCTGGCCGGG - Intronic
1036544921 8:9758675-9758697 AGCGGGTCCCAGCCCTTGCCAGG - Intronic
1036667233 8:10755119-10755141 TGTGGGCTCCAGTCCTGACCTGG + Intronic
1036694315 8:10964716-10964738 GAGGGGCCCCTGCCCTGACCAGG - Intronic
1037598637 8:20374804-20374826 TGGAGGTCCCAGCCCTGAGGAGG - Intergenic
1037855336 8:22367405-22367427 TTGGCGTCCCCGCCCTCACCTGG - Exonic
1039609021 8:38904276-38904298 TGGAGGTCCCAGCCCTGCTGGGG + Intronic
1040752747 8:50729959-50729981 TGGGAGTGCTAACCCTGACCTGG + Intronic
1047927169 8:129693214-129693236 TGGGGGCCCCTGACTTGACCTGG - Intergenic
1048986234 8:139736611-139736633 TGGGGGTCCCAGGGGAGACCAGG - Intronic
1048993520 8:139775105-139775127 TGGGGCACCTAGCCCTGACTGGG + Intronic
1049227936 8:141466589-141466611 AGGGAGGCCCAGCCCTGCCCTGG + Intergenic
1049471719 8:142777663-142777685 TCGGGGTCCCAGCGCTTGCCCGG - Intronic
1049476873 8:142801002-142801024 TGGGTGCCCCTGCCCTGCCCTGG - Intergenic
1049508971 8:143018399-143018421 TGGGGGTCCCCGCGCCGCCCAGG - Intronic
1049624794 8:143615154-143615176 GGTGGGGCCCAGCCCTGAGCTGG - Intronic
1049624825 8:143615240-143615262 TGGGAGCCCCAGCCCAGCCCAGG - Intronic
1049664168 8:143835657-143835679 CGTGGGACCCAGGCCTGACCCGG - Exonic
1049781770 8:144432396-144432418 TGGGAGCCCCTGCCCTGGCCAGG - Exonic
1049819156 8:144623992-144624014 TGGGCGTCCCAGCTAAGACCTGG + Intergenic
1049852121 8:144838359-144838381 TGGGGTCCTCAGCCCTAACCAGG + Intronic
1052857239 9:33415071-33415093 TGGGGGTTCCAGGCATGACAGGG + Intergenic
1059251660 9:112891695-112891717 TGGAGGTCTCAGCCCAGCCCAGG - Intergenic
1059666112 9:116448042-116448064 TCGGGGACCCAGGCCTGACGTGG - Intronic
1060229122 9:121814071-121814093 TGGGACCCCCAGCCCTGCCCTGG - Intergenic
1060596989 9:124854327-124854349 TGGGGCTCCCACACCTGGCCGGG + Intronic
1061064136 9:128267056-128267078 TGGGGGGCCCAGGCCTCAGCTGG - Intronic
1061267424 9:129514897-129514919 AGGGGGTCACAGCCCTGGCTTGG - Intergenic
1061908379 9:133710393-133710415 TGAGGGTCCCAGGGCTGACCGGG - Intronic
1062087814 9:134657737-134657759 CGGGGGTGCCAGGCCTGACGGGG + Intronic
1062332661 9:136051427-136051449 CAGGGGTCCCAGCCCTCGCCGGG + Intronic
1062490769 9:136803863-136803885 TGGGGGCCCAAGGACTGACCTGG + Intronic
1188405134 X:29798020-29798042 CGGGGGGCTCAGCCCTGACTTGG + Intronic
1188445260 X:30248205-30248227 TGGGAGTCCCAGGCCAGAGCTGG + Intronic
1192797951 X:74440130-74440152 TAGGTGGCCCAGCCATGACCAGG + Intronic
1193121661 X:77829517-77829539 TGGGAGTCCCAGACCAGACTGGG - Intronic
1194114125 X:89874278-89874300 TGTGGGTCCCATCACTTACCTGG + Intergenic
1194655688 X:96570531-96570553 TGGGCATCCCAGCACTGTCCAGG + Intergenic
1195682810 X:107561460-107561482 TGGGGGCACAAGACCTGACCTGG + Intronic
1196458093 X:115903879-115903901 TGTGGGGCCCTGCCCTGTCCTGG + Intergenic
1196483901 X:116181890-116181912 TGGGGCTCCCTGCCCTGTCCTGG - Intergenic
1196856651 X:119991051-119991073 ATGGGGTCCCAGCCCAGATCCGG + Intergenic
1198109211 X:133487850-133487872 TGGGGGTCCCAGACATGCCATGG + Intergenic
1200003369 X:153072997-153073019 TAGGGTTCCCAGCGCGGACCAGG - Exonic
1200004354 X:153077012-153077034 TAGGGTTCCCAGCGCGGACCAGG + Intergenic
1200064280 X:153497238-153497260 TGGGGCTCCCAGGCCTGTCGGGG - Intronic
1200126214 X:153816183-153816205 TGGGGCTCCCAGGCCTGTCGGGG + Intronic
1200207414 X:154327127-154327149 TGTGGGTCCCAGCCCTGCCCTGG + Intronic
1200466866 Y:3529634-3529656 TGTGGGTCCCATCACTTACCTGG + Intergenic
1202366784 Y:24171096-24171118 TGGGGCACCCAGGCCTCACCTGG + Intergenic
1202373623 Y:24214386-24214408 TGGGGCACCCAGGCCTCACCTGG - Intergenic
1202378786 Y:24259407-24259429 TGGGCTTCCCTGCCCTGAGCAGG - Intergenic
1202491996 Y:25410714-25410736 TGGGCTTCCCTGCCCTGAGCAGG + Intergenic
1202497158 Y:25455734-25455756 TGGGGCACCCAGGCCTCACCTGG + Intergenic
1202503998 Y:25499027-25499049 TGGGGCACCCAGGCCTCACCTGG - Intergenic