ID: 1147403618

View in Genome Browser
Species Human (GRCh38)
Location 17:40195350-40195372
Sequence GTGCATCAGCAGTAGCAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147403618_1147403621 0 Left 1147403618 17:40195350-40195372 CCTCCCTGCTACTGCTGATGCAC 0: 1
1: 0
2: 2
3: 32
4: 234
Right 1147403621 17:40195373-40195395 TCTCCTCTCCCTGCAGCCCCTGG 0: 1
1: 7
2: 31
3: 241
4: 1407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147403618 Original CRISPR GTGCATCAGCAGTAGCAGGG AGG (reversed) Exonic
900408780 1:2503720-2503742 GGGCCCCAGCAGCAGCAGGGTGG + Intronic
900908477 1:5577407-5577429 GTGCAGGAGCAGTAGAAGGGAGG - Intergenic
901777419 1:11569899-11569921 GAGCATCAGCGGAACCAGGGAGG + Intergenic
901908637 1:12436408-12436430 GTGCAGCAGCAGGACTAGGGAGG + Intronic
902271905 1:15310681-15310703 GTGCACAAGCAGCAGCCGGGAGG - Intronic
903373031 1:22849126-22849148 GTGCAGCAGCAGTGGGAGTGGGG - Intronic
905910923 1:41653751-41653773 GTGGCTCAGCAGTTGAAGGGTGG + Intronic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906714434 1:47956382-47956404 GAGCATGAGCTGAAGCAGGGCGG + Intronic
910898810 1:92097052-92097074 GTTCATCAGTAATAACAGGGAGG - Intronic
915088767 1:153406770-153406792 GGGGATCAGCAGTGGCTGGGAGG + Intergenic
915815774 1:158963162-158963184 CTGCAGCAGCAGTGGCAGAGGGG - Intronic
915858924 1:159421887-159421909 GGGTACCAGCAGTGGCAGGGAGG + Intergenic
917461611 1:175235051-175235073 GGGCATCAGCTGTAGTAGTGTGG - Intergenic
919278451 1:195452039-195452061 GTGTTTCAGCAGTAGCAGGAGGG + Intergenic
919662691 1:200262820-200262842 GTGCACCAGTAGCAGCAAGGAGG - Intergenic
922041847 1:221904515-221904537 TTGCACCAGCTGCAGCAGGGAGG - Intergenic
923550498 1:234959382-234959404 CTGGATGAGCAGTAGCAAGGAGG - Intergenic
924632394 1:245753097-245753119 ATGCATCACCAGTAGCAAAGGGG + Intronic
924886938 1:248229066-248229088 GGATATCAGCAGAAGCAGGGTGG + Intergenic
1063603613 10:7504763-7504785 TTGGATTAGGAGTAGCAGGGGGG + Intergenic
1064000631 10:11661203-11661225 AGGCACCAGCAGGAGCAGGGGGG + Intergenic
1064382657 10:14860611-14860633 GTGCCTGAGGAGCAGCAGGGAGG + Intronic
1065902734 10:30223164-30223186 GGGCACCAGCATTAGCAGTGTGG - Intergenic
1066657847 10:37712057-37712079 GAGCATCAGCTGGAGCAGGCTGG - Intergenic
1067576410 10:47411326-47411348 ATGGATCACCAGGAGCAGGGAGG + Intergenic
1067658980 10:48219437-48219459 GTGTATCAGTAGGAGCAGAGAGG - Intronic
1071237227 10:83663264-83663286 GTCCATCAGTATTAGCATGGAGG - Intergenic
1071277205 10:84066119-84066141 GGGCATAAGCAGGTGCAGGGAGG - Intergenic
1071813300 10:89206915-89206937 GTGCAGCAGCAGGAGCAGCTCGG + Exonic
1072423665 10:95310862-95310884 GGGCAATAGCAGAAGCAGGGAGG + Intergenic
1072568662 10:96639770-96639792 GAGCCTCAGCAGTCACAGGGAGG + Intronic
1073648600 10:105334458-105334480 GTGCATCAACTCTAGGAGGGAGG + Intergenic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075726624 10:124613862-124613884 GTGCCTGGGCAGTCGCAGGGAGG - Exonic
1077063347 11:627108-627130 GAGCAGCAGCAGCAGCAGGAGGG + Exonic
1077370016 11:2177448-2177470 GGGCAGCAGCAGTAGCAGAAGGG - Intergenic
1077455082 11:2673617-2673639 GGTCATCAGCAGTAGCAAGGTGG - Intronic
1077841646 11:5982255-5982277 GTGCATTGGCAGTGGAAGGGTGG + Intergenic
1078694773 11:13620279-13620301 GTGCACCAGTAGCAACAGGGTGG + Intergenic
1081165975 11:39809813-39809835 GAGCACAAGCAGAAGCAGGGTGG + Intergenic
1081634581 11:44712296-44712318 CTGCAGCAGCAGTGGCAGGTTGG + Intergenic
1082670624 11:56032970-56032992 GTGGGTGAGCAGAAGCAGGGTGG + Intergenic
1083164179 11:60873477-60873499 GTGCAGCAGCAGGACCAGGTTGG - Exonic
1084731543 11:71076746-71076768 GTGCCTCTGCAGGAGCAGGGTGG - Intronic
1084925795 11:72510462-72510484 GGGCATTAGCTGGAGCAGGGTGG + Intergenic
1086135446 11:83439535-83439557 GTGCATTGGCAGTGGCAGGAAGG + Intergenic
1086590827 11:88511629-88511651 GTGCATCCATAGTAGCAGAGGGG + Intronic
1088206448 11:107397654-107397676 GAGCATCAGCTGTAGTAGGGTGG - Intronic
1091210495 11:133854314-133854336 ATGCATCAGCTGTAGTAGTGTGG + Intergenic
1096076901 12:48811568-48811590 GTGCATCAGCAGACCCAGAGGGG + Intergenic
1096900819 12:54879540-54879562 GTGCATCAGTATTAGGAGGTGGG - Intergenic
1097264579 12:57737997-57738019 GTGGATCAGCACGAGCAGCGCGG - Exonic
1099965483 12:89440795-89440817 GAGCATGAGCCGAAGCAGGGCGG + Intronic
1100416194 12:94378678-94378700 ATGCATCAGCATTAGCTTGGGGG + Intronic
1101340895 12:103841189-103841211 GGGCAGCAGCAGTCGCAGAGCGG - Exonic
1102035684 12:109769383-109769405 GGGCATCAGCAGGCACAGGGTGG - Exonic
1102951162 12:117032640-117032662 GGGCAACAGCAGCACCAGGGTGG - Intergenic
1105805601 13:23950244-23950266 GGGGATCAGCACTAGGAGGGAGG - Intergenic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1107826439 13:44332727-44332749 AGGCAGCAGCAGCAGCAGGGAGG - Intergenic
1112579722 13:100668143-100668165 GTGCATCTTCAGCAGCAGGCAGG - Intronic
1115604929 14:34991671-34991693 GTGTAGCAGCAATAGCAAGGAGG + Intronic
1115942750 14:38627561-38627583 TTGCTGCAGCAGTAGCAGGTTGG - Intergenic
1117639868 14:57786403-57786425 GAGCATCAGCTGTAGTAGTGTGG - Intronic
1118446221 14:65853473-65853495 GTGGATCTGCAGTAGGAGTGGGG + Intergenic
1118490165 14:66251220-66251242 GGGCTTCAGCAGTACCAGTGTGG - Intergenic
1119391776 14:74295863-74295885 GTGCATCAGGAGAAGCTGGAGGG - Exonic
1119412616 14:74443403-74443425 GTGGATGAGGAGTGGCAGGGTGG + Intergenic
1120137195 14:80884503-80884525 GTGGATGAGCAGAAGTAGGGTGG + Intronic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1121511556 14:94516512-94516534 GTGCACCAGCAGGTGAAGGGGGG + Intronic
1121590341 14:95101610-95101632 GGGCAGTGGCAGTAGCAGGGAGG - Intronic
1124848776 15:33315755-33315777 CCGCATCAGCAGTAGGGGGGTGG + Intronic
1127143375 15:55999674-55999696 GTCCAACAGCAGTGGCAGTGAGG + Intergenic
1127529159 15:59826004-59826026 GTGCATCAGAATCAACAGGGAGG + Intergenic
1128628377 15:69235956-69235978 GTTAATCAGCAGTGGCAGGAAGG - Intronic
1128809274 15:70558535-70558557 GTGGAGCAGCAGTAGGAGGGAGG - Intergenic
1129490902 15:75924597-75924619 GTGCATGAGCACTGCCAGGGAGG - Intronic
1130958764 15:88645809-88645831 GTGCATCAGCAACAGCAAGGAGG - Intronic
1132819927 16:1859907-1859929 GAGCCTCAGCAGGAGCCGGGAGG - Intronic
1135531460 16:23258369-23258391 GTGCAATAGCAGCAGCAGGTAGG + Intergenic
1135546139 16:23368028-23368050 GACCATCAGCTGTTGCAGGGTGG + Intronic
1136019337 16:27430091-27430113 GAGCAGCAGCAGGAGCAAGGGGG - Exonic
1136991856 16:35157552-35157574 GTGCGTGAGCCGAAGCAGGGCGG + Intergenic
1137525079 16:49228245-49228267 GAGCATGAGCCGAAGCAGGGTGG + Intergenic
1139085968 16:63586375-63586397 GTTCATCAGCAGCAACAGTGTGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141462762 16:84187469-84187491 GTGCGTCAGCAGTAGCACCTGGG + Intergenic
1142592241 17:1011389-1011411 CTGAACCAGCAGGAGCAGGGAGG + Intronic
1143434349 17:6912614-6912636 GTGAAGCAGCAGTATCACGGGGG + Intronic
1146358922 17:32158902-32158924 GGCCATCAGCTGCAGCAGGGAGG + Intronic
1147403618 17:40195350-40195372 GTGCATCAGCAGTAGCAGGGAGG - Exonic
1147741544 17:42673405-42673427 GTCCCTGAGCAGTAGCTGGGTGG + Exonic
1148439142 17:47702808-47702830 GTGCATCCTCAGGAGCAGGGTGG - Intronic
1148835760 17:50464943-50464965 GTGCATCAGCAGAGGCTGTGGGG + Exonic
1149951419 17:60991336-60991358 GTACATCAGCAGTAGTAGAAAGG - Intronic
1150945642 17:69743032-69743054 GAGCATCAGCTGTGGCAGTGTGG + Intergenic
1151808215 17:76419977-76419999 GTGCATTCGCAGTTGCAGGGAGG - Intronic
1152788081 17:82262265-82262287 CTGCTTCAGCAGTAGCCTGGGGG + Intronic
1155708603 18:28847529-28847551 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
1156855064 18:41772293-41772315 ATGCAGCAGCAGTAGCAGCTGGG + Intergenic
1158311780 18:56166943-56166965 GAGCCTCAGCAGCAGCAGGCAGG + Intergenic
1159120533 18:64163997-64164019 CTACATCAGCAGTAGCAGGAAGG + Intergenic
1160377369 18:78423185-78423207 CAGCAGCAGCAATAGCAGGGGGG - Intergenic
1163163007 19:15476586-15476608 GTCCATGAGCAGGGGCAGGGAGG + Exonic
1164495291 19:28754820-28754842 GTGCACCAGCAGTGGCAGGGTGG - Intergenic
1164672853 19:30082793-30082815 GTGCCTCACCAGCAGCCGGGAGG - Intergenic
1164854165 19:31507661-31507683 GGGCACCAGCATTAGCACGGAGG - Intergenic
1165216434 19:34277056-34277078 GAGCATCATGAGTAGGAGGGAGG + Intronic
1165287541 19:34854181-34854203 CTGCATCAGAAGATGCAGGGTGG + Intergenic
1167294018 19:48639048-48639070 GTGCATCTGCAGTGGAAGGAGGG + Exonic
1167300331 19:48674084-48674106 GTGCATCAGCTGCAGGAGGATGG + Intergenic
925442655 2:3901633-3901655 GTGCGTCAGCAGTAGCTCAGTGG - Intergenic
925592727 2:5526355-5526377 GTACAGCAGCAGTAGCAGACCGG - Intergenic
927523958 2:23720720-23720742 AGGCATCAGCAGTGGCAGTGGGG - Intergenic
927662410 2:25004067-25004089 CTCCATCAGAAGTACCAGGGAGG + Intergenic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
932819556 2:74887795-74887817 GTGCATCAGCAGTGGCAGACAGG - Intronic
936572472 2:113627955-113627977 GTGCAGAAGCAGTAGCTGTGTGG + Intronic
938038048 2:128053029-128053051 AAGCATCAGCTGTAGCAGTGTGG + Intergenic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
944471301 2:200055930-200055952 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
944939555 2:204608735-204608757 ATGCATATGCAGGAGCAGGGAGG - Intronic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
946306089 2:218857850-218857872 CTGCAATAACAGTAGCAGGGTGG + Intergenic
946939763 2:224758534-224758556 TTGTAGCAGCAGTAGCAGGTGGG + Intergenic
947488485 2:230573917-230573939 GAGCACGAGCAGTAGCTGGGTGG - Intergenic
1169329917 20:4708279-4708301 ATGCATCAGCTGAAGCAGGCAGG - Intergenic
1169668767 20:8071146-8071168 GTGCACGTGCTGTAGCAGGGAGG + Intergenic
1170094449 20:12630417-12630439 GTGCTTCTGCTGTAGCAAGGAGG - Intergenic
1172027111 20:31956077-31956099 GTTGATCAGGAGTAGCAGGAGGG - Intergenic
1172116364 20:32575683-32575705 GGCCATGAGCACTAGCAGGGCGG - Intronic
1175418788 20:58818288-58818310 GGTCTTCAGCAGAAGCAGGGAGG - Intergenic
1175903572 20:62369285-62369307 GTGCACCAGCAGACACAGGGTGG - Intergenic
1176660486 21:9630473-9630495 GTTAATCAGCATTAGCGGGGAGG + Intergenic
1177042787 21:16133485-16133507 GTGGGTGAGCAGAAGCAGGGTGG - Intergenic
1179281755 21:39939712-39939734 ATGCATCAGCATTAGCTGGAAGG - Intergenic
1181450962 22:23020394-23020416 ATGCATCAGGAGTAGGAGGCAGG + Intergenic
1181507986 22:23374600-23374622 GTGCAGGAGCAGCAGCATGGGGG - Intergenic
1181845044 22:25700040-25700062 GTGTTTCAGCAGAAGCAAGGGGG - Intronic
1181982508 22:26775469-26775491 GGACATCAGCAGGAGCAAGGGGG + Intergenic
1182453621 22:30435678-30435700 GTGCACCAGCAGGGGCAGGGAGG - Intergenic
1182697635 22:32207305-32207327 GTGCCAGAGCAGTAGGAGGGCGG + Intergenic
1184333245 22:43839066-43839088 GTGCACCAGCAGGTTCAGGGAGG - Intronic
1184479452 22:44738167-44738189 CCGCATCAGCCGTAGCAGGCAGG + Intronic
1185330596 22:50250555-50250577 GGTCACCAGCAGGAGCAGGGGGG + Intronic
1185427715 22:50782924-50782946 GTGCAGAAGCAGTAGCTGTGTGG - Exonic
951469145 3:23036404-23036426 GAGCATGAGCCGAAGCAGGGTGG - Intergenic
951477199 3:23119469-23119491 GAACAGCAGCAGCAGCAGGGGGG - Intergenic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
952294713 3:32051136-32051158 GTGCATCAAGAGTAGCAAGAAGG - Intronic
953507095 3:43496903-43496925 GTGCATCATCAGGAACAGGAAGG - Intronic
954630710 3:52046368-52046390 GCACATGGGCAGTAGCAGGGAGG + Intergenic
955230856 3:57097759-57097781 GTGCAGCAGGGGTTGCAGGGCGG + Exonic
956193468 3:66629574-66629596 CTGCAGCAGCAGCAGCGGGGAGG + Intergenic
958677975 3:97292043-97292065 GTGCACCAGCTGTAGCAGGTTGG + Intronic
960643888 3:119856446-119856468 GTACATCCAAAGTAGCAGGGTGG + Intronic
961431894 3:126889516-126889538 GTGGCTCAGCAGGAGCTGGGTGG - Intronic
961602675 3:128073315-128073337 GGGCATCAGCAGGTCCAGGGAGG - Intronic
963474372 3:145785618-145785640 GTGAATTATCAGTAGCAGGTGGG - Intergenic
967170578 3:186820203-186820225 AGGCAGCAGCAGTAGCATGGTGG + Intergenic
968334527 3:197901569-197901591 GAACATCAGCAGTAGCCTGGCGG + Intronic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969615751 4:8251730-8251752 GGGCATCAGCCGTCGCTGGGAGG + Intergenic
970897953 4:21125145-21125167 GTGCATCAGAATCAGCAGGAGGG + Intronic
971195421 4:24468888-24468910 CTGCAACATCAGTAGCAGGCAGG - Intergenic
971534865 4:27736169-27736191 GGGCAGCAGCAGTTGCTGGGAGG - Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
975076332 4:70213192-70213214 GAGCATGAGCTGAAGCAGGGCGG - Intergenic
975811964 4:78178928-78178950 GTGCATCAGCGGTAGTTAGGGGG - Intronic
976357572 4:84137131-84137153 GTGCAGAAGCAGAGGCAGGGTGG - Intergenic
984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG + Intergenic
985414873 4:189725942-189725964 GTTAATCAGCATTAGCGGGGAGG - Intergenic
985994725 5:3591573-3591595 GTCCCTCAGCAGCAGCTGGGAGG - Intergenic
986466924 5:8034997-8035019 GAGCAGCAGCAGCACCAGGGAGG + Intergenic
986899317 5:12412717-12412739 GAACATCAGCAGTAGTATGGAGG - Intergenic
987642882 5:20634129-20634151 GTGCATCAGCAGTGATAGGCAGG - Intergenic
988723519 5:33903172-33903194 AAGCATCAGCTGTAGCAGTGTGG + Intergenic
988902262 5:35745807-35745829 GAGCATCAGCTGTAGTAGCGTGG - Intronic
988944027 5:36176708-36176730 ATGTATCAGCAATAGCAGGCTGG - Intronic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
989068921 5:37490294-37490316 TTGCAGCAGCAGTAGTAGGCAGG + Intronic
989175624 5:38522225-38522247 GTGCTTCAGCAGTTGCAGGCAGG + Intronic
992483782 5:77176502-77176524 GGGCATGAGCAGGAGGAGGGTGG + Intergenic
993069057 5:83135189-83135211 GAGCATGAGCCGAAGCAGGGTGG - Intronic
993429490 5:87814240-87814262 GTGCACCAGCAGTAGCTGGGTGG - Intergenic
993658620 5:90602830-90602852 GTGGCTCAGCAGAAGCTGGGTGG + Intronic
994350230 5:98737357-98737379 GAGCATAAGCTGAAGCAGGGTGG + Intergenic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
995902059 5:117081404-117081426 GTGAAAAAGTAGTAGCAGGGAGG + Intergenic
996477831 5:123941541-123941563 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
998821293 5:146060059-146060081 GTGCATCAGCAGGGGCAGTGAGG + Exonic
998977002 5:147659328-147659350 GAGAACCAGCAGAAGCAGGGTGG - Intronic
999115345 5:149158035-149158057 GTGAATGAGAGGTAGCAGGGTGG - Intronic
1000412362 5:160947051-160947073 GAGCATGAGCCGAAGCAGGGTGG - Intergenic
1001135282 5:169097699-169097721 GCGCAGCAGCAGTAGCAGGAGGG + Intronic
1001234413 5:170017452-170017474 ATGCATCAGAAGTAGCAGATAGG - Intronic
1002199628 5:177520443-177520465 GTCCATCAGCAGGGGCTGGGAGG + Intronic
1004294158 6:14394964-14394986 GTCCATCAGAAGTACCAGAGAGG + Intergenic
1005106062 6:22225542-22225564 GTTCATCTGAAGTAGCAGGTGGG - Intergenic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1008557933 6:52693443-52693465 ATGCATCACCAGTAGCAGCATGG - Intergenic
1009239219 6:61163570-61163592 GTGCATGAGCCGAAGCAGGGTGG - Intergenic
1010671699 6:78694469-78694491 GAGCATGAGCTGAAGCAGGGCGG + Intergenic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012799010 6:103801997-103802019 GAGCATGAGCCGAAGCAGGGCGG + Intergenic
1012933194 6:105338564-105338586 GAGCATGAGCCGAAGCAGGGCGG + Intronic
1013822970 6:114177438-114177460 TTGCATTAGCAAAAGCAGGGTGG - Intronic
1014045609 6:116882184-116882206 ATACATCAGCAGAGGCAGGGAGG - Intronic
1015289568 6:131523298-131523320 ATGCAACAGCATTAGCAGGTGGG - Intergenic
1015693715 6:135956402-135956424 GAGCATCAGCAGCAGAAGGTGGG + Intronic
1015851366 6:137575895-137575917 GTGCACCAGGAGTAACAGTGGGG + Intergenic
1016875911 6:148864468-148864490 GAGCATGAGCCGAAGCAGGGCGG - Intronic
1019490681 7:1311819-1311841 GGGCAGCAGCCGTAGCTGGGCGG + Intergenic
1022275161 7:28847756-28847778 CTGCATCAGCTGGAGCTGGGAGG + Intergenic
1022615551 7:31926634-31926656 GTGGGCCAGCAGAAGCAGGGTGG + Intronic
1023791485 7:43757260-43757282 TTGCATAAGAAATAGCAGGGAGG + Intergenic
1024332581 7:48170928-48170950 GTGCAGGTGCAGTAGCAGAGTGG + Intergenic
1024417083 7:49119978-49120000 GTGCATCAGCAGCAGCATGAGGG + Intergenic
1025091297 7:56066282-56066304 GTGCATCAGCTGAAGCAGTATGG + Intronic
1025772825 7:64528808-64528830 GAGCATCAGCTGTGGTAGGGTGG - Intronic
1027591042 7:80119669-80119691 TTGAATCAGAAGTAGCAGGAGGG - Intergenic
1029032997 7:97488440-97488462 CTGCCCCAGCAGTTGCAGGGAGG + Intergenic
1030462158 7:109853201-109853223 GGGCAAGAGCAGAAGCAGGGTGG - Intergenic
1030462300 7:109854562-109854584 GTTCAACAGCAGTAGCATTGGGG - Intergenic
1031192830 7:118576563-118576585 TTGCATCAGTAGTAGCAGCATGG + Intergenic
1031870133 7:127082079-127082101 GAGCATCTGCAGGAGCAGTGTGG - Intronic
1032002433 7:128274152-128274174 GTGCTTCTGCAGTACCAGGGAGG - Intergenic
1037399550 8:18480593-18480615 GTTCATCAGTAGTAGAATGGAGG - Intergenic
1037606734 8:20444233-20444255 GTGCTTCAGCAGTGGCAGGCAGG - Intergenic
1038170729 8:25128960-25128982 CTGCTGCAGCAGTGGCAGGGCGG - Intergenic
1039141507 8:34394103-34394125 ATGCATCTGCAGTCCCAGGGAGG - Intergenic
1040289961 8:46119218-46119240 GTGAATAAGCAGTCGCAGGGTGG - Intergenic
1041085858 8:54255660-54255682 TGGCATCAGCATTAGCTGGGAGG + Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1045088161 8:98710318-98710340 GAGCATGAGCTGAAGCAGGGCGG + Intronic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1046121083 8:109848346-109848368 GTGCACCAGTAGTGGCAGGGTGG + Intergenic
1046615320 8:116471160-116471182 GTGCATTAGCTGAGGCAGGGAGG + Intergenic
1046900745 8:119521145-119521167 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1048083632 8:131154869-131154891 GTGCAGGAGCAGTAGAAAGGTGG + Intergenic
1048518626 8:135133629-135133651 GTGCAGCAGCATTTGCAGTGGGG + Intergenic
1049391432 8:142373572-142373594 GTCCATCAGCTGTAGGATGGTGG - Intronic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1050261817 9:3848997-3849019 GTGCAGCAGCAGTGGGAAGGGGG - Intronic
1050986719 9:12091948-12091970 GTGCAGCAGCAGCAGCATGCTGG + Intergenic
1051362715 9:16295051-16295073 GAGCATCAGCTGTAGTAGTGTGG - Intergenic
1052583268 9:30389871-30389893 GTACATTAGCAGCAGCAAGGTGG - Intergenic
1059454369 9:114390236-114390258 GTGCATGAGCAAAGGCAGGGAGG - Intronic
1060018109 9:120104701-120104723 GTGCATCTGCAGTAACAGGAAGG + Intergenic
1061643699 9:131981635-131981657 GTGCATCCGCAATAGCAGGAAGG + Intronic
1061789042 9:133048930-133048952 GTGCATGAGGACTGGCAGGGAGG + Intronic
1203638056 Un_KI270750v1:132316-132338 GTTAATCAGCATTAGCGGGGAGG + Intergenic
1186516566 X:10170682-10170704 GTGCATCAGCATTACCAGGAGGG - Intronic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1188375374 X:29421996-29422018 GTGCATGAGGAGAACCAGGGTGG + Intronic
1189888802 X:45577436-45577458 GGGCACCAGCAGTAGCAAGGAGG + Intergenic
1191128186 X:56980618-56980640 GGGCAGCAGCAGTAGCAGCGTGG + Intronic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1192949176 X:75998100-75998122 GAGCATGAGCTGAAGCAGGGTGG - Intergenic
1193352211 X:80476756-80476778 CTGTATCTGCAGTAGCAGTGAGG + Intergenic
1193562581 X:83037636-83037658 GAGGGTGAGCAGTAGCAGGGTGG + Intergenic
1193882103 X:86936184-86936206 GTGCATCAGTAGTGGCATGGGGG + Intergenic
1196603049 X:117623388-117623410 GAGGGTCAGCAGAAGCAGGGTGG - Intergenic
1196788776 X:119445461-119445483 GTGCAGCAACAGTAGTGGGGTGG + Intronic
1198312953 X:135438105-135438127 GTGCTGCAGCAGTGGCAGGAGGG + Intergenic
1198592370 X:138198452-138198474 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1199247134 X:145618631-145618653 ATCCATCAGCAGGAGCAAGGGGG + Intergenic