ID: 1147405787

View in Genome Browser
Species Human (GRCh38)
Location 17:40211050-40211072
Sequence ACCGTGCTCAGTCTTCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147405787_1147405794 10 Left 1147405787 17:40211050-40211072 CCCCTTTGAAGACTGAGCACGGT No data
Right 1147405794 17:40211083-40211105 TGTAATCCCAACACTTTGGGAGG No data
1147405787_1147405798 19 Left 1147405787 17:40211050-40211072 CCCCTTTGAAGACTGAGCACGGT No data
Right 1147405798 17:40211092-40211114 AACACTTTGGGAGGCTGAGGCGG No data
1147405787_1147405796 16 Left 1147405787 17:40211050-40211072 CCCCTTTGAAGACTGAGCACGGT No data
Right 1147405796 17:40211089-40211111 CCCAACACTTTGGGAGGCTGAGG No data
1147405787_1147405791 6 Left 1147405787 17:40211050-40211072 CCCCTTTGAAGACTGAGCACGGT No data
Right 1147405791 17:40211079-40211101 TGCCTGTAATCCCAACACTTTGG No data
1147405787_1147405799 20 Left 1147405787 17:40211050-40211072 CCCCTTTGAAGACTGAGCACGGT No data
Right 1147405799 17:40211093-40211115 ACACTTTGGGAGGCTGAGGCGGG No data
1147405787_1147405792 7 Left 1147405787 17:40211050-40211072 CCCCTTTGAAGACTGAGCACGGT No data
Right 1147405792 17:40211080-40211102 GCCTGTAATCCCAACACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147405787 Original CRISPR ACCGTGCTCAGTCTTCAAAG GGG (reversed) Intergenic