ID: 1147408982

View in Genome Browser
Species Human (GRCh38)
Location 17:40235537-40235559
Sequence GGCTTTATGAAAGGAGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147408976_1147408982 22 Left 1147408976 17:40235492-40235514 CCTCTTCTCATCATTGAAGCACA 0: 1
1: 0
2: 3
3: 17
4: 152
Right 1147408982 17:40235537-40235559 GGCTTTATGAAAGGAGTCTTTGG 0: 1
1: 0
2: 2
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147408982 Original CRISPR GGCTTTATGAAAGGAGTCTT TGG Intronic
901744063 1:11361023-11361045 GGCTTAATGAAGGGTGCCTTCGG + Intergenic
906859351 1:49342261-49342283 GGATTTGTGAGATGAGTCTTAGG + Intronic
908997380 1:70172111-70172133 GCCCTTATAAAAGAAGTCTTGGG + Intronic
909914132 1:81296696-81296718 GGATTTCTGAAAAGATTCTTGGG - Intergenic
910647469 1:89529104-89529126 GTCTTTCTCACAGGAGTCTTAGG + Intronic
912645221 1:111385941-111385963 GGCTTTATAAAATGTGACTTTGG + Intergenic
912677652 1:111700041-111700063 GGAATTAGGAAAGGAGACTTAGG - Intronic
917017397 1:170548845-170548867 AGATTTATGAAAGGGTTCTTTGG + Intronic
918377828 1:183926872-183926894 GGCTGTATGAAAGGCCACTTTGG + Exonic
920449803 1:206051360-206051382 GGCTTTTATGAAGGAGTCTTTGG + Intronic
921595542 1:217050227-217050249 AGCTTAATGAATGGATTCTTTGG + Intronic
1065632288 10:27692806-27692828 GGTTTTATGAACAGAGTATTTGG + Intronic
1067368843 10:45663085-45663107 GGTTTTCCGAAAAGAGTCTTTGG - Intronic
1067372400 10:45697483-45697505 GGCCTTCTGGAAGGGGTCTTCGG + Intergenic
1067387378 10:45828645-45828667 GGCCTTCTGGAAGGGGTCTTCGG - Intronic
1067418746 10:46128608-46128630 GGCCTTCTGGAAGGGGTCTTCGG + Intergenic
1067446892 10:46355956-46355978 GGCCTTCTGGAAGGGGTCTTCGG + Intergenic
1067504100 10:46835185-46835207 GGCCTTCTGGAAGGGGTCTTCGG + Intergenic
1067590489 10:47504805-47504827 GGCCTTCTGGAAGGGGTCTTCGG - Intronic
1067875884 10:50007438-50007460 GGCCTTCTGGAAGGGGTCTTCGG + Intronic
1070123394 10:73600198-73600220 GGCCTTATGAAAAGAGCCCTTGG - Intronic
1070134208 10:73677335-73677357 GGCCTTCTGGAAGGGGTCTTCGG - Intronic
1070498955 10:77052414-77052436 GGCTTTCTGAAAGGAGCCCTGGG + Intronic
1074951831 10:118344325-118344347 GGCTTTAAGATAGGAATTTTAGG + Intergenic
1075533202 10:123247863-123247885 AGCTTTAGGACAGAAGTCTTTGG + Intergenic
1079869282 11:25776396-25776418 AGCTTTATGAAAAGAGTTTCTGG + Intergenic
1080084664 11:28265069-28265091 GGCTTTGTGAAATGATTCTGTGG + Intronic
1082056044 11:47817282-47817304 TGCTTTACAAAAGGATTCTTTGG - Intronic
1085806481 11:79641512-79641534 TGCTTTATGAAAGATGCCTTAGG + Intergenic
1087015572 11:93551433-93551455 TGCTTTCAGAGAGGAGTCTTGGG + Intergenic
1091514162 12:1161253-1161275 CCCTGTATGAAAGGAGTCTGAGG + Intronic
1093286867 12:17274652-17274674 GACTTTATGAAGGTAGTCTTAGG + Intergenic
1100516586 12:95334067-95334089 GGATTTATGAGAGGAGGCCTTGG - Intergenic
1101182603 12:102235746-102235768 GGCTTAATGAAAAGAGATTTAGG - Intergenic
1102569645 12:113819628-113819650 AGCTTTCTGAAAGGCGGCTTCGG - Intronic
1102961365 12:117095574-117095596 GGCAGTAAGAAAGCAGTCTTGGG + Intronic
1103418047 12:120757890-120757912 GCCTTTATTAAAGGGCTCTTGGG + Intergenic
1104104484 12:125646033-125646055 GGCTTTCTGTAAGGTGACTTGGG - Intronic
1110645254 13:77875929-77875951 GACTTAATTAAATGAGTCTTCGG + Intergenic
1113526564 13:110983093-110983115 TGCTTTTTGCAAGGAGTCATTGG + Intergenic
1113700890 13:112387497-112387519 GGATTTGTGAAACTAGTCTTAGG - Intronic
1116680749 14:47966697-47966719 GGCTTTATTTTAGCAGTCTTTGG - Intergenic
1117284173 14:54270400-54270422 GGCTCTATGAAAGGTTTTTTGGG + Intergenic
1117817472 14:59612494-59612516 GGATTTGTGAAACTAGTCTTAGG + Intronic
1118873116 14:69759886-69759908 GACATTATGAATAGAGTCTTTGG + Intronic
1119772067 14:77226254-77226276 GCCTCTGTGATAGGAGTCTTTGG - Intronic
1120374254 14:83680893-83680915 GGCTGCATGAAAGCAGTCTCTGG - Intergenic
1123019575 14:105391408-105391430 GGCTTTGTGACAGCAGTCCTTGG - Intronic
1127082828 15:55397297-55397319 CGCTTTTTAAAAGGAGTCTTAGG - Intronic
1127563716 15:60166181-60166203 GGCCTAAGGAAAGGAGTTTTGGG + Intergenic
1128820342 15:70646706-70646728 GGCTTAATGGAAGGAGGATTTGG + Intergenic
1130608195 15:85336492-85336514 GGCTTTAAGAAGGAAGTCTTGGG - Intergenic
1133743009 16:8665521-8665543 GTCTTTGTGAAATGAATCTTGGG - Intergenic
1138140444 16:54563781-54563803 GGCTTTATGAAAAGAGGCCATGG + Intergenic
1140773402 16:78227311-78227333 GGCTTTATTTAAGGAGTCTTGGG + Intronic
1141336090 16:83156738-83156760 GGATTTATGGAAGGAGGCTGGGG - Intronic
1141481455 16:84309387-84309409 GGCTTTATGAAAGGCACCTGTGG - Intronic
1144143840 17:12377815-12377837 GGATTTATCAAATGAATCTTCGG - Intergenic
1144770108 17:17754966-17754988 GGCTTTATGAACACAGGCTTTGG + Intronic
1147312323 17:39602804-39602826 GGCTTTAGGATGGGAGTCTTTGG + Intergenic
1147408982 17:40235537-40235559 GGCTTTATGAAAGGAGTCTTTGG + Intronic
1151147833 17:72057882-72057904 GGCTTAAGAAAAGGTGTCTTTGG - Intergenic
1157794982 18:50565032-50565054 GTCTTTGGGAAAGCAGTCTTTGG + Intronic
1158556002 18:58475242-58475264 GGCTTCAACAGAGGAGTCTTAGG - Intergenic
1158994583 18:62904884-62904906 GGTTTTATGGAAGGACCCTTGGG + Intronic
1162994041 19:14322283-14322305 GGCTTCAGGAAGGGAGTATTTGG + Intergenic
1163398462 19:17077382-17077404 GCCTTTAGGAAAGGTGGCTTTGG + Intronic
1164413598 19:28026567-28026589 GGCATGATCTAAGGAGTCTTTGG + Intergenic
1168633292 19:57974139-57974161 GGTTTTATGAAAGAACACTTTGG + Exonic
927513784 2:23660267-23660289 GGCTTTACGTAAGGTGGCTTAGG + Intronic
928245109 2:29620047-29620069 GGCATTACGAAAGGGGTCATTGG - Intronic
930128386 2:47822586-47822608 GGCTTTATGGAAGTAGATTTTGG - Intronic
934755635 2:96822826-96822848 GGCATTATGAAAGGGTACTTTGG + Intronic
935060475 2:99602826-99602848 GGATTTATGAAAGTCCTCTTTGG - Intronic
937504137 2:122517153-122517175 GAATTTATGAAAGGACTCTCAGG + Intergenic
944207934 2:197176462-197176484 GGCTTGAAGATAGAAGTCTTGGG - Intronic
946509252 2:220336333-220336355 GAATTTATTAAAGGAGTTTTTGG + Intergenic
946620915 2:221561632-221561654 TGCTTTATGGAAATAGTCTTGGG - Intronic
947681901 2:232041580-232041602 GGTTGTACCAAAGGAGTCTTGGG + Intronic
948764705 2:240213443-240213465 GGCTTAATGACAGAAGTCTGAGG + Intergenic
949063102 2:241972938-241972960 GAATTTATGGAAGGAGTCCTTGG + Intergenic
1170181065 20:13530617-13530639 GGCTTTATAAGAGGTGTCCTTGG - Intronic
1173688521 20:44940870-44940892 GGCATTTTGAAAGAAGCCTTAGG - Intronic
1175049694 20:56143275-56143297 GGCTTTTTGAATGAAGACTTTGG + Intergenic
1176728128 21:10460788-10460810 GGGTTTATGAAAGAATTCTAGGG + Intergenic
1181145594 22:20843878-20843900 GGGTTTATGAGAGAAGTTTTGGG - Intronic
1181323110 22:22023838-22023860 GGCTTGATTAAATGAGGCTTAGG - Intergenic
1183608076 22:38878600-38878622 GCCTTTGTGAAAGGAGTGTCTGG - Intergenic
1184719274 22:46300394-46300416 GGCTTTAAGAAAAGAATTTTAGG - Intronic
1185262545 22:49876920-49876942 GGATTCATCAAAGGAATCTTTGG - Intronic
953811637 3:46117582-46117604 AGGATTATGAATGGAGTCTTTGG + Intergenic
953867904 3:46600045-46600067 GGCTTTCTGAAGTGAGTCATGGG - Intronic
953879075 3:46682233-46682255 GGCTTTCTGCAAGGAATGTTCGG - Intronic
955870632 3:63434704-63434726 GGCTTTAAGAAATGTGTGTTAGG + Intronic
956800627 3:72754679-72754701 GGCCTTAAGAAAGGACACTTTGG - Intronic
956820843 3:72952814-72952836 GGCTTTTGGAAAGGGGCCTTTGG - Intronic
957341864 3:78910019-78910041 GTCTTTATGAAATGTGTCTACGG - Intronic
958718505 3:97817156-97817178 GGCTTTATGAAACAAAGCTTTGG - Intergenic
964109345 3:153072937-153072959 AGCTCTCTGAACGGAGTCTTGGG + Intergenic
964188633 3:153977289-153977311 GACTTTATAAAAGGAGTTATAGG - Intergenic
970911002 4:21275568-21275590 GGCTTTCTCATAGGAGTGTTGGG - Intronic
974611963 4:64229205-64229227 GTCTTTCTAAAAGGAGTCTCTGG - Intergenic
977711376 4:100129749-100129771 GATTTTATGAAAGGATACTTAGG - Intergenic
980133632 4:128840130-128840152 GGATTTATGAAAGCAGTCCTAGG + Intronic
980534640 4:134101567-134101589 GGCTTCATGAGAGGTTTCTTTGG - Intergenic
986131367 5:4934896-4934918 GGATGTATATAAGGAGTCTTTGG + Intergenic
987413297 5:17635712-17635734 GGCTTGAGGAAAGGTGGCTTTGG - Intergenic
990370730 5:55115561-55115583 GACTCTATGAAAGGAGCCTGAGG + Intronic
991278873 5:64886689-64886711 GCCTTTATGAAAATAGTCATTGG - Intronic
994910164 5:105894642-105894664 GGCCTTATGTAAAGAGTCTGAGG - Intergenic
995783369 5:115801757-115801779 GGCTTTACAAAAGAAGTCTGTGG + Intergenic
997298862 5:132787702-132787724 GGCTTTATCAAAGAAGCCTAGGG - Intronic
999693918 5:154171648-154171670 GGCTTTTTGAAAGGGGTGTCTGG - Intronic
1003967539 6:11267430-11267452 GGCATTATGAAAAGATACTTGGG - Intronic
1005527519 6:26665587-26665609 GGCTGAATGAAAGGAATCTTGGG - Intergenic
1006784198 6:36654217-36654239 GGCTTTATGGAAGGATTCAGAGG - Intergenic
1007392254 6:41556290-41556312 GGCTATAGGAAAGCACTCTTGGG + Intronic
1010353362 6:74902340-74902362 GCCTTTCTTAAAGGAGTCTTTGG + Intergenic
1011291234 6:85779442-85779464 GGCTTGATGCAAGTAGACTTGGG - Intergenic
1011721422 6:90160788-90160810 GTCTTTATGAAAGGATTTTTGGG + Intronic
1013408579 6:109864367-109864389 GGCTTTATGCAAGGGGTCCATGG - Intergenic
1015389862 6:132669534-132669556 TGTTTTCTGAAAGGAGTTTTGGG - Intergenic
1015825629 6:137308389-137308411 TGGATTATGAAAGGGGTCTTGGG - Intergenic
1016836988 6:148487413-148487435 GGTTTTGGGAAAGGTGTCTTTGG + Intronic
1017973806 6:159336573-159336595 GTCTTTATTATTGGAGTCTTTGG - Intergenic
1018080007 6:160251180-160251202 GGCTTTGTGAAAATTGTCTTTGG + Intronic
1022804266 7:33806181-33806203 GGATTTCTGAAAGGAATCATGGG + Intergenic
1026542298 7:71290308-71290330 CGCTTTATGACAAGAGTCTTTGG + Intronic
1027854125 7:83487014-83487036 GGCTTTATGAACTGCATCTTAGG - Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1030395016 7:108975164-108975186 GACTTTATGACAGGTCTCTTTGG + Intergenic
1031811505 7:126375351-126375373 AGCTCTATGAGAGAAGTCTTAGG + Intergenic
1032605208 7:133343344-133343366 GGGTTTCTGCAAAGAGTCTTGGG + Intronic
1034601967 7:152267242-152267264 GGGTTTATGAAAGAATTCTAGGG - Intronic
1037958945 8:23081951-23081973 GGCTTTAAGATAGGATTATTGGG + Intergenic
1039635504 8:39160091-39160113 GGCAGTATGAAAGGCGACTTAGG + Intronic
1040115203 8:43609567-43609589 GGCTCTATGAAGGGACTTTTGGG + Intergenic
1040821513 8:51563486-51563508 GGCTTCAAGATAGGAGTCTTGGG + Intronic
1041385425 8:57297352-57297374 AGCTTTGTGAAAGGAACCTTAGG - Intergenic
1041578416 8:59427426-59427448 GGCTTTTTTAGAGGAGTTTTAGG - Intergenic
1041991879 8:64002552-64002574 GGCTTTATGAGTGGAATCTAGGG + Intergenic
1042623423 8:70731178-70731200 GGATTTGTGAAACTAGTCTTAGG - Intronic
1046299334 8:112266182-112266204 GGATATATTAATGGAGTCTTGGG - Intronic
1046308620 8:112403624-112403646 GCCTTTATAAAAGAAGTCTGAGG - Intronic
1049598077 8:143493546-143493568 GGCTTTGTGAGTGGAGTCCTTGG - Intronic
1049962217 9:747765-747787 GGATTTGTGACAGGAGGCTTGGG + Intergenic
1050520252 9:6489880-6489902 GGCTTTCTGAAAGGCGGATTTGG + Intronic
1050648757 9:7752337-7752359 GGATTTATCAAATGAATCTTTGG - Intergenic
1051258540 9:15238363-15238385 GTCTTTTTGGGAGGAGTCTTTGG - Intronic
1051347798 9:16168274-16168296 GGCCTTAGGAAAGGCATCTTGGG - Intergenic
1052315221 9:27109522-27109544 GGGTTTTTGAAAGGATCCTTGGG + Exonic
1055765957 9:79663931-79663953 GGCTTTATGAAGTGCGTCTCGGG - Intronic
1057522675 9:95772466-95772488 TGCTTTTTAAAAGGAGTCTGTGG + Intergenic
1190298545 X:49042915-49042937 GGCTTTATTAAAGGAGTCGTGGG - Intronic
1190785104 X:53638972-53638994 GTCTTTATGAAAAGTGACTTTGG - Intronic
1197068927 X:122270047-122270069 GGCTTGAGGAAAGGAGGCTGTGG - Intergenic