ID: 1147412325

View in Genome Browser
Species Human (GRCh38)
Location 17:40262617-40262639
Sequence GAACCATCCTTGGCTCCCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 316}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147412325_1147412329 4 Left 1147412325 17:40262617-40262639 CCTGTGGGAGCCAAGGATGGTTC 0: 1
1: 0
2: 1
3: 40
4: 316
Right 1147412329 17:40262644-40262666 ATCTGATGAGTACTTTCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 153
1147412325_1147412328 3 Left 1147412325 17:40262617-40262639 CCTGTGGGAGCCAAGGATGGTTC 0: 1
1: 0
2: 1
3: 40
4: 316
Right 1147412328 17:40262643-40262665 TATCTGATGAGTACTTTCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 132
1147412325_1147412330 15 Left 1147412325 17:40262617-40262639 CCTGTGGGAGCCAAGGATGGTTC 0: 1
1: 0
2: 1
3: 40
4: 316
Right 1147412330 17:40262655-40262677 ACTTTCCCAGGGTATTTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147412325 Original CRISPR GAACCATCCTTGGCTCCCAC AGG (reversed) Exonic
900347139 1:2215239-2215261 GCACCACCCTTGGCCCCCTCAGG - Intergenic
901005452 1:6169680-6169702 GAAGCCTCCTTTGCCCCCACGGG - Intronic
901677156 1:10892226-10892248 AAACCCTCCATGGCTCCCACTGG + Intergenic
902454283 1:16520959-16520981 GAACCATCCCAGGAGCCCACAGG - Intergenic
902498171 1:16889357-16889379 GAACCATCCCAGGAGCCCACAGG + Intronic
905206299 1:36344506-36344528 GACCCATGCCTGGCTCCCAGGGG - Intronic
909431453 1:75591696-75591718 GAACCATTCTTGCATCCCAGGGG - Intronic
910351262 1:86300521-86300543 GAACCGTCCTTGCATCCCAGGGG + Intergenic
910748411 1:90599668-90599690 GAACCAGCCTTGCATCCCAAGGG - Intergenic
911404910 1:97424482-97424504 GAAGCATCCTTTACTCCCATAGG + Intronic
912508793 1:110174593-110174615 GAGGAATCCTAGGCTCCCACTGG - Intronic
913655073 1:120952623-120952645 GAACCATCCCGGGAGCCCACCGG - Intergenic
914509371 1:148317725-148317747 GAGCCATCCTGGGAGCCCACCGG - Intergenic
914645258 1:149646783-149646805 GAACCATCCCGGGAGCCCACCGG - Intergenic
915052268 1:153088062-153088084 GAACCAACCTTGCATCCCAAGGG - Intergenic
915077484 1:153321020-153321042 GAATCATTCTTAGCTCCCAGAGG - Intergenic
915119486 1:153619912-153619934 TAGCCATCCTTGCCTTCCACTGG - Intronic
916848681 1:168680575-168680597 GAACCAGCCTTGCATCCCAGGGG + Intergenic
916936710 1:169635717-169635739 GAACCATCCTTGCATCCCAGGGG - Intergenic
917266980 1:173231265-173231287 GAACCAGCCTTGCATCCCAGGGG - Intergenic
917467229 1:175291107-175291129 GAACCAGCCTTGCATCCCAAGGG - Intergenic
917517468 1:175719875-175719897 GAAACATACTTGGCTCCAACAGG - Intronic
918159764 1:181887428-181887450 GAACCAGCCTTGCATCCCAGGGG + Intergenic
919376505 1:196801049-196801071 GCACCATCCTTGCATCCCACAGG + Intergenic
919386203 1:196925962-196925984 GCACCATCCTTGCATCCCACAGG + Intronic
920284903 1:204872331-204872353 GGACTCTCCTTGGCTCCCACAGG + Intronic
921636446 1:217500371-217500393 GGAACTTCCTTGGCTCTCACTGG + Intronic
923676794 1:236087450-236087472 GAGCAATCCTGGGCTCCCAATGG + Intergenic
923893620 1:238243151-238243173 GTTCCATCCTTTGCTCCCACAGG - Intergenic
924868230 1:248009836-248009858 GAACCATCCTTGCATTCCAGGGG - Intronic
1064563536 10:16616686-16616708 GAACCAGCCTTGCATCCCAGGGG - Intronic
1065074606 10:22064521-22064543 GAACCACCCTTGCATCCCAGGGG - Intergenic
1065195610 10:23262269-23262291 GGACCAGCCTTGACTCCCACTGG + Intergenic
1065251824 10:23823297-23823319 GGACCACCCTTGGCTCCCAGAGG + Intronic
1068567939 10:58596232-58596254 GAACCAGCCTTGCATCCCAGGGG - Intronic
1069635110 10:69920218-69920240 GCACCTTCTGTGGCTCCCACTGG + Intronic
1072377558 10:94833821-94833843 GAACCATCCTTGCATCCCAGAGG + Intronic
1072394004 10:95019778-95019800 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1073431351 10:103489530-103489552 CAACTATCCCTGGCTACCACAGG - Intergenic
1073490244 10:103848471-103848493 GAACCTTCCTTTTCTCCCAAGGG - Intronic
1074000273 10:109365191-109365213 GAACCAACCTTGCATCCCAGGGG + Intergenic
1074791269 10:116889891-116889913 GGTCCACTCTTGGCTCCCACGGG + Intronic
1075232147 10:120689682-120689704 CAAACATACTGGGCTCCCACTGG + Intergenic
1076470726 10:130716396-130716418 GGACCAGCCTTGGCTGCCTCTGG + Intergenic
1076600507 10:131654351-131654373 GAGCCATCCTTGGCACCCTGGGG + Intergenic
1078952050 11:16145170-16145192 GAACCAGCCTTGCATCCCAGGGG - Intronic
1079510210 11:21201948-21201970 GAACCAGCCTTGTATCCCAGGGG + Intronic
1079934893 11:26605238-26605260 GAACCAGCCTTGTATCCCAGGGG + Intronic
1080706585 11:34701291-34701313 CACCCATTCCTGGCTCCCACGGG - Intergenic
1081309077 11:41548594-41548616 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1082959517 11:58905580-58905602 AACCCCTCCTTGGCTTCCACTGG + Intronic
1083073137 11:60007946-60007968 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1084173837 11:67413224-67413246 GACCCATCCCTGTCTACCACTGG - Intronic
1084931964 11:72563003-72563025 GAACCATCATTGGCCCATACAGG + Intergenic
1086007268 11:82051846-82051868 GAACCATCCTTGCATCCCCAGGG - Intergenic
1087599063 11:100289429-100289451 GAACCAGCCTTGCATCCCAGGGG - Intronic
1087877205 11:103372547-103372569 GAACCATCCTTGCATCCCTGGGG + Intronic
1089469059 11:118706408-118706430 GAACAGTCCCTGGCACCCACAGG + Intergenic
1090270209 11:125380732-125380754 CACCCATCCCTGGCTCACACAGG + Intronic
1090933056 11:131316338-131316360 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1093477069 12:19567884-19567906 GAACCAGCCTTGCATCCCAGGGG - Intronic
1095397482 12:41777299-41777321 GATCCATCCTTGGTTCCCCAAGG + Intergenic
1096890827 12:54769283-54769305 GAACCAGCCTTGCATCCCAGTGG + Intergenic
1097917123 12:65032770-65032792 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1098301324 12:69056863-69056885 AAGCCATCTTTGGCTGCCACAGG + Intergenic
1098649409 12:72945333-72945355 GAACCATCCTTGCATCCCTAGGG - Intergenic
1098664889 12:73149943-73149965 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1099235101 12:80074444-80074466 GAACCAGCCTTGCATCCCATGGG + Intergenic
1099238591 12:80112565-80112587 GAACCAGCCTTGTATCCCAGGGG + Intergenic
1099882575 12:88484727-88484749 GAACCATCCTTGCATCCCTGGGG - Intergenic
1102997617 12:117361980-117362002 TAACCATCCCTGCCTCCCATGGG - Intronic
1104514977 12:129416864-129416886 GAACCAGCCTTGCATCCCAGGGG + Intronic
1104934772 12:132358558-132358580 GAAGCATCCCTGGCTCACTCAGG - Intergenic
1107072543 13:36286698-36286720 AAACCACCCTTCGCTCCCTCTGG + Intronic
1107295471 13:38902434-38902456 AACCCATCCTTGCCTCCCAGAGG - Intergenic
1107656854 13:42600275-42600297 GAACGATGCTTAGCTCCCAGTGG - Intronic
1108510529 13:51151755-51151777 AAGCCTTCCTTGGCTCCCCCAGG - Intergenic
1110393674 13:75005208-75005230 GAACCATCCTTGTGTCCTAGGGG - Intergenic
1110888856 13:80673266-80673288 GAACCATCCTTGCATCCTAGGGG + Intergenic
1111655075 13:91141703-91141725 GAACCATCCTGGTCACCCAGAGG + Intergenic
1113250517 13:108447323-108447345 GACCCATCCTTGCCTCCTCCTGG - Intergenic
1114762234 14:25329072-25329094 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1117577679 14:57115888-57115910 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1119409546 14:74421831-74421853 GAACACTTCTTGGCTCCCACGGG + Intronic
1119732917 14:76962493-76962515 GAACCCTCCCTGGCTCCCCAGGG - Intergenic
1121423368 14:93831412-93831434 GAAACAGCCCTGGCACCCACGGG - Intergenic
1121890220 14:97583328-97583350 GAACAATCATTAGCTCTCACCGG - Intergenic
1121938923 14:98049093-98049115 GAACCACCTTTGGCTGCCAGGGG - Intergenic
1122428109 14:101623359-101623381 GCACCATCCATGGCTCCCTGTGG - Intergenic
1122433310 14:101672454-101672476 GAACCACCCTTGCATCCCAGGGG - Intergenic
1122800599 14:104227609-104227631 CAACCATCCTTAGATTCCACAGG - Intergenic
1202842520 14_GL000009v2_random:135470-135492 GAACCACCCTTGCATCCCAGGGG + Intergenic
1202911909 14_GL000194v1_random:125711-125733 GAACCACCCTTGCATCCCAGGGG + Intergenic
1125458116 15:39881136-39881158 GTACCATGCTTTGCTCTCACTGG + Intronic
1126202325 15:46000974-46000996 GAACCATCCTTGCATCCCTGGGG + Intergenic
1127177655 15:56378040-56378062 GAACCATCCTTGCATCCCTGGGG + Intronic
1127330058 15:57930245-57930267 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1127570955 15:60240980-60241002 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1129489698 15:75912093-75912115 GAACCAGCCTTGCATCCCAGGGG + Intronic
1130908102 15:88253988-88254010 TGACCATCCCTGCCTCCCACTGG + Intronic
1131314874 15:91326819-91326841 GAACCATCCTTGCATCCCCGGGG + Intergenic
1132852815 16:2032584-2032606 GAGCCACCCTTAGCTCCCAGGGG - Intronic
1132998520 16:2836923-2836945 GAACGCTCCTTGACCCCCACGGG - Intronic
1133963054 16:10511098-10511120 GAACAAACCATGGCTCCCAGTGG - Intergenic
1135344434 16:21676564-21676586 GAACAATCCTTGGACCTCACAGG - Intergenic
1136748694 16:32614408-32614430 CAGCCATCATTGTCTCCCACAGG + Intergenic
1137224849 16:46493661-46493683 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1138631788 16:58301250-58301272 GAACCATCCTTGCATTCCAGAGG - Intronic
1140239882 16:73191284-73191306 GAACGTTCCGTGGCTCCCCCCGG + Intergenic
1141010993 16:80398833-80398855 GAACCATCCTTGGATCCCAGGGG - Intergenic
1141510234 16:84507133-84507155 GAACTCTCCTTGGCTCCCAGAGG + Intronic
1203050827 16_KI270728v1_random:873622-873644 CAGCCATCATTGCCTCCCACAGG + Intergenic
1147412325 17:40262617-40262639 GAACCATCCTTGGCTCCCACAGG - Exonic
1147461385 17:40572403-40572425 GAACCAACCTTGCATCCCAGGGG - Intergenic
1148124864 17:45231363-45231385 GGCCCAGCCTTGGCTCCCAGGGG - Intronic
1148154584 17:45415614-45415636 GAATCATCCTTGCCTCCTGCTGG + Intronic
1148456331 17:47813403-47813425 GCACCTTCCTTGCCCCCCACAGG - Exonic
1149532789 17:57408772-57408794 GAACCACCCCTTGCACCCACTGG - Intronic
1150386478 17:64765577-64765599 GAATCATCCTTGCCTCCTGCTGG + Intergenic
1150484723 17:65535920-65535942 GTCCCATCCTGGGCTCCCAGGGG - Intronic
1151252389 17:72846566-72846588 GAACCATCCTGGCCTTCCATTGG + Intronic
1152284594 17:79404722-79404744 GAACCATCCATGGCTCCCTGTGG + Intronic
1152360335 17:79830402-79830424 GCTCCATCCCTGGATCCCACTGG - Intergenic
1152727457 17:81954657-81954679 GAAGCTTGCTTGCCTCCCACAGG + Intronic
1153371733 18:4324688-4324710 GAACCAACCTTGCTTCCCAGGGG - Intronic
1153522780 18:5967887-5967909 CAACAATCCCTGGCTCCCCCTGG - Intronic
1153623375 18:7000740-7000762 GAACCAGACTTGGCTCTAACTGG - Intronic
1155568173 18:27160431-27160453 GAACCAGCCTTGCATCCCAGGGG + Intronic
1156755090 18:40513758-40513780 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1157773063 18:50367280-50367302 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1160485372 18:79286939-79286961 GAACCAGCCTTGCATCCCAGGGG + Intronic
1160908109 19:1461162-1461184 GAAGCATCCCTGCCGCCCACCGG - Intronic
1161316345 19:3619323-3619345 GGCCCCTCCTCGGCTCCCACTGG - Intronic
1161640145 19:5417451-5417473 GAACCCTCATTGGCTCCCTAGGG - Intergenic
1164110919 19:22157844-22157866 GAACCACCCTTGCATCCCAGGGG + Intergenic
1164495863 19:28760668-28760690 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1165292994 19:34904478-34904500 GAAGCTTCCTTGGCTCACACAGG - Intergenic
1167468232 19:49661479-49661501 AGACCATCCTTGGATTCCACGGG + Intronic
1167507876 19:49880719-49880741 GCACCATCCTGGGGTCACACAGG + Intronic
925056834 2:862915-862937 GAAGCATCCTTGGCCACCAGTGG - Intergenic
925747082 2:7052461-7052483 GAACCATCCTTGGAGGCCACAGG - Intronic
926065552 2:9836784-9836806 CCACCATCATTGGCTCCCACTGG - Intergenic
927035013 2:19165324-19165346 GAACCAGCCTTGCATCCCAGGGG - Intergenic
927459539 2:23285964-23285986 GAACCATCATTAACTCCCAGGGG + Intergenic
928482993 2:31702489-31702511 GAACCATCCTTGCATCCCAGAGG - Intergenic
929556494 2:42928803-42928825 AAACTGTCCTTGGCTCCCCCAGG + Intergenic
930972460 2:57412958-57412980 GAACCATCCTTGCATCCCTGGGG - Intergenic
931204314 2:60132514-60132536 GAACCAGCCTTGCATCCCAGGGG + Intergenic
931744456 2:65280005-65280027 AAAAAATCCTTGGCTCCCACAGG - Intergenic
932560839 2:72867392-72867414 TGCCCACCCTTGGCTCCCACAGG - Intergenic
934999002 2:98992873-98992895 GAACCAGCCTTGCATCCCAGGGG - Intergenic
936142982 2:109956769-109956791 GAACCAGCCTTGCATCCCAGGGG - Intergenic
936179670 2:110254735-110254757 GAACCAGCCTTGCATCCCAGGGG - Intergenic
936201706 2:110414698-110414720 GAACCAGCCTTGCATCCCAGGGG + Intronic
937196145 2:120158408-120158430 GAACCAACCTTGCATCCCAGGGG - Intronic
937291481 2:120784783-120784805 AAACCTTCCTTGACTCCCTCAGG + Intronic
937978148 2:127593864-127593886 GAAGCCTCCTGGGCTTCCACAGG - Intronic
938632990 2:133189604-133189626 GAACCAGCCTTGCATCCCAGGGG - Intronic
939840961 2:147186202-147186224 GAACCAGCCTTGCATCCCAGGGG - Intergenic
940695711 2:156975283-156975305 GAACCATCCTTGCATCTCAGGGG + Intergenic
940795764 2:158076490-158076512 GAACCATCCTTGCATCCCTATGG - Intronic
941797656 2:169618174-169618196 GAACCATTCTTGCATCCCAGAGG + Intronic
941965311 2:171294908-171294930 GAACCATGCCTTGCTCCCACTGG - Intergenic
942733048 2:179080312-179080334 GAACCACCCTTGCATCCCAGGGG - Intergenic
942899670 2:181099347-181099369 GAACCATCCTTGCATCCAAGGGG - Intergenic
945058343 2:205887489-205887511 GAACCAGCCTTGTCCCACACAGG + Intergenic
946255498 2:218438779-218438801 GCAGCGTTCTTGGCTCCCACAGG - Intronic
946866122 2:224042474-224042496 AAACCGTCCTTAGCTCCCAGTGG + Intergenic
947146265 2:227068537-227068559 GAACCAGCCTTGCATCCCAGGGG - Intronic
947193983 2:227542480-227542502 GAACCAGCCTTGCATCCCAGGGG + Intronic
948744879 2:240082084-240082106 CAACCATCATTGTCTCCCAAAGG - Intergenic
1169310028 20:4528921-4528943 GAACCATCCTTGAATCCTAGAGG - Intergenic
1171825810 20:29903097-29903119 GAACCAGCCTTGCATCCCATGGG + Intergenic
1175386318 20:58597580-58597602 AAACGATCCTTGGCACCCAGTGG - Intergenic
1175434613 20:58935202-58935224 GAATCATCCTTGCATCCCAAGGG - Intergenic
1176631269 21:9140378-9140400 GAACCACCCTTGCATCCCAGGGG + Intergenic
1179828813 21:43983269-43983291 GAAGCATCCTAGAGTCCCACAGG - Exonic
1180375318 22:12087220-12087242 GAACCATCCTTGCATCCCAGGGG - Intergenic
1180575497 22:16769779-16769801 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1180622824 22:17173040-17173062 GTGCCATCCTTGGCTCTCACAGG - Intergenic
1181628490 22:24137435-24137457 GTACCAGCCTTCCCTCCCACAGG - Intronic
1182085577 22:27558869-27558891 GAACCATGATTGGGTCCCACTGG - Intergenic
1182952285 22:34388675-34388697 GAACCAGCCTTGCATCCCAGAGG + Intergenic
1183793672 22:40097094-40097116 GAACCATCCTTACATCTCACTGG + Intronic
1184750552 22:46484043-46484065 GAACATTCCCAGGCTCCCACGGG + Intronic
1185008424 22:48299459-48299481 GAGGTATCCTGGGCTCCCACAGG + Intergenic
949401904 3:3673646-3673668 GAACCAGCCTTGCATCCCAGGGG - Intergenic
949409783 3:3751091-3751113 GATACATCCTTAGCACCCACAGG + Intronic
949846456 3:8375696-8375718 GAACCAGCCTTGCATCCCAGGGG - Intergenic
950827456 3:15839722-15839744 GAACCATCCTTGCATCCCTCGGG - Intronic
951414775 3:22410883-22410905 GAACCAGCCTTGCATCCCAAGGG + Intergenic
952250883 3:31652501-31652523 GAACCATCCTTGCATCCCTGAGG - Intergenic
953047795 3:39311005-39311027 GAACCACCCTTGCATCCCAGGGG + Intergenic
953866424 3:46587038-46587060 AAAGCATCCTGGGCTGCCACTGG + Intronic
953886186 3:46715564-46715586 GCACCATCATTGCCTCCCAGTGG - Exonic
954510150 3:51117284-51117306 GAATCAGCCTTGCCTCCCAGGGG + Intronic
955371225 3:58353913-58353935 GGACCTTCCATGGCTCCCACTGG - Intronic
955386065 3:58481444-58481466 GAACCATCCTTGCATCCCTGGGG + Intergenic
956471622 3:69573119-69573141 AAGCCATCCTTGCCTCTCACTGG - Intergenic
956926493 3:73994517-73994539 GAACCAGCCTTGCATCCCAGGGG - Intergenic
957005027 3:74935001-74935023 GAACCAGCCTTGCATCCCAGGGG + Intergenic
957810042 3:85210295-85210317 GAACCATCCATGTCTCCCTGGGG + Intronic
959290363 3:104466159-104466181 GAACCAGCCTTGCGTCCCAGGGG + Intergenic
960065725 3:113370400-113370422 GAACCAGCCTTGCATCCCAGGGG - Intronic
960893311 3:122474683-122474705 GAACCATCCTTGTATCCCTGAGG - Intronic
963616054 3:147539530-147539552 GAACCAACCTTGCATCCCAGGGG + Intergenic
964659241 3:159101472-159101494 GAAGCAACCTTGCCTCCAACAGG - Intronic
965047807 3:163601607-163601629 GAATCATCCTTGCATCCCAGGGG - Intergenic
966518036 3:180841429-180841451 GAACTATCCTTGCATCCCATGGG + Intronic
968804202 4:2762037-2762059 GCACCTTCTTTGACTCCCACAGG + Intergenic
971797548 4:31248023-31248045 GAACCATCCTTGCATCCCTGGGG - Intergenic
973140023 4:46755107-46755129 GAACCATCCTTTACTCCCTGGGG - Intronic
973943844 4:55937594-55937616 GAACCATCCTTGCATCCCTGGGG + Intergenic
974261730 4:59533407-59533429 GAACCAGCCTTGCATCCCAGGGG - Intergenic
974363837 4:60918977-60918999 GAACCAGCCTTGCATCCCAGTGG - Intergenic
975035397 4:69674152-69674174 GAACCATCCTTGCATCTCAGGGG - Intergenic
975100405 4:70506713-70506735 GCACCATGCTTGGCTCCTAGTGG - Intergenic
976506136 4:85849769-85849791 GAACCATCCTTGCATCCCAGGGG + Intronic
976992463 4:91384010-91384032 GAATCAACTTTGGCTCCCAGTGG + Intronic
977403515 4:96564989-96565011 GCACCATCCTGGTCTCCCATTGG + Intergenic
978736525 4:112090154-112090176 GAACCAGCCTTGCATCCCAGGGG - Intergenic
980514672 4:133839797-133839819 GAACCATCCTTGGATTCCATAGG + Intergenic
981188839 4:141837442-141837464 GAACCAGCCTTGCATCCCAGGGG - Intergenic
982890869 4:160848550-160848572 TAACCAAAATTGGCTCCCACAGG - Intergenic
983485750 4:168330129-168330151 GAACCAGCCTTGCATCCCAGGGG + Intergenic
984102288 4:175500001-175500023 CACTCATCCCTGGCTCCCACTGG + Intergenic
984251514 4:177341806-177341828 AAATCATCTTTGGCTCCCTCAGG - Intronic
985072612 4:186182703-186182725 GAACCATCCTTGCATCCCAGGGG + Intergenic
1202756915 4_GL000008v2_random:72661-72683 GAACCATCCTTGCATCCCAGGGG - Intergenic
985629744 5:1008405-1008427 GAACCAGCGTTGGCCCCCCCCGG - Intergenic
986140918 5:5028867-5028889 GAACCAGCCTTGCATCCCAGGGG - Intergenic
986898993 5:12408513-12408535 GAAACATCCTTGTATCCCAGGGG + Intergenic
987479340 5:18433139-18433161 GAACCAGCCTTGCATCCCAGGGG - Intergenic
989950922 5:50296396-50296418 GAACCAGCCTTGCATCCCAGGGG - Intergenic
990840388 5:60073331-60073353 GAACCAACCTTGCCTCCCATGGG + Intronic
991506659 5:67331769-67331791 GAATCATCCTTGAATCCCAGGGG + Intergenic
993253698 5:85559852-85559874 GAACCAGCCTTGCATCCCAGGGG - Intergenic
993403042 5:87476371-87476393 GAACCAGCCTTGCATCCCAGGGG - Intergenic
995312210 5:110726641-110726663 CAACCAGCCTTGGTTCCCAGCGG - Exonic
995526527 5:113054793-113054815 AAACCTTCCTGGGCTGCCACAGG - Intronic
996306011 5:122048366-122048388 GAACCAGCCTTGCATCCCAGGGG + Intronic
996466705 5:123811068-123811090 TAACCTTCCTTGGCTGTCACAGG - Intergenic
996987087 5:129580754-129580776 GAACCAGCCTTGTATCCCAGGGG + Intronic
997188677 5:131908251-131908273 GAACCATCCTTGCGTCCCTGGGG - Intronic
1000400389 5:160820711-160820733 GAACCATCCTTGCATCCCAGGGG - Intronic
1000854332 5:166379760-166379782 GAAGCCCCCTTGACTCCCACAGG - Intergenic
1001179838 5:169509655-169509677 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1002906628 6:1454336-1454358 GAACCATCTGTGGCAACCACAGG + Intergenic
1003797925 6:9626839-9626861 GAACCATCTTTGCCTCCCAGAGG + Intronic
1005170947 6:22984004-22984026 GAACCAACCTTGCATCCCAGGGG + Intergenic
1006717981 6:36132177-36132199 CATCCATCCTTGCCTGCCACAGG - Intronic
1006752607 6:36387956-36387978 GACCTGGCCTTGGCTCCCACTGG + Intergenic
1010812101 6:80312751-80312773 GAACCAACCTTGCATCCCACGGG + Intronic
1011379517 6:86727508-86727530 CAACCCTCTGTGGCTCCCACTGG + Intergenic
1011397809 6:86928352-86928374 AAACCATCCTAGGCAACCACTGG - Intergenic
1012013835 6:93829499-93829521 GAACCAACCTTGGATCCCAGAGG + Intergenic
1012372205 6:98521637-98521659 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1012407324 6:98914488-98914510 GAACCAGCCTTGCATCCCAGAGG - Intronic
1012616429 6:101284157-101284179 GAACCGTCCTTGGTACCCTCGGG + Intergenic
1013319876 6:108977319-108977341 GAACCAGCCTTGCATCCCAGAGG + Intergenic
1014292815 6:119579657-119579679 GAACAATCCTTGCATCCCAGGGG - Intergenic
1015291504 6:131542708-131542730 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1015367478 6:132413036-132413058 GTTCCATACTTGGATCCCACAGG - Intergenic
1015461119 6:133492279-133492301 GAACCATCCTTGCATCCCTGGGG - Intronic
1016600466 6:145853018-145853040 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1019313899 7:375936-375958 GAGCTGTCCGTGGCTCCCACTGG + Intergenic
1019514742 7:1434750-1434772 GAAACATCCTTCCCTTCCACTGG + Intronic
1020761340 7:12270629-12270651 GAAGCTTCCTTGGCTGACACTGG - Intergenic
1020824127 7:13005718-13005740 GAGCCATCCTTGCATCCCAGGGG + Intergenic
1021160488 7:17266753-17266775 GAACCATCCTTGCATCCCAGGGG + Intergenic
1021380042 7:19955601-19955623 GATCCAGCCTTGGCTCAAACGGG + Intergenic
1022247029 7:28570543-28570565 GAGCCCTCCTTGGCTGCCCCTGG + Intronic
1023322675 7:39016298-39016320 GAACCCTACTTGGCTCACAGTGG - Intronic
1024144975 7:46505028-46505050 GAACCATCCTTGCATCCCAGGGG - Intergenic
1024249111 7:47492886-47492908 GAACGGGCCTTGGCTCTCACAGG - Intronic
1024532501 7:50405519-50405541 TCAGCATCCTAGGCTCCCACTGG + Intergenic
1025521023 7:61730034-61730056 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1025545377 7:62159595-62159617 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1028159452 7:87469043-87469065 GAACCAGCCTTGCATCCCAGGGG - Intronic
1028279573 7:88905269-88905291 GAACCAACCTTGCATCCCAGAGG + Intronic
1028734013 7:94186369-94186391 GAACCAGCCTTGCATCCCAGAGG + Intergenic
1030019452 7:105258704-105258726 GAACCAGCCTTGCATCCCAGGGG - Intronic
1034700813 7:153094225-153094247 GAACCTTCCTTGGTCCCCAGTGG + Intergenic
1034709317 7:153176892-153176914 ATACTTTCCTTGGCTCCCACTGG + Intergenic
1035785044 8:2253420-2253442 GAACCATCCTTGGACACCAGGGG - Intergenic
1035807767 8:2468296-2468318 GAACCATCCTTGGACACCAGGGG + Intergenic
1037034507 8:14148856-14148878 GAACTATCCTTGCATCCCAGAGG - Intronic
1037487004 8:19357068-19357090 GATCCACCCAAGGCTCCCACTGG - Intronic
1037879869 8:22567297-22567319 GAACTGTCCTTGGCCCCCACAGG + Intronic
1038742777 8:30230504-30230526 GAACATACCTTGTCTCCCACAGG - Intergenic
1038878501 8:31579602-31579624 GAACCAACCTTGCATCCCAGGGG - Intergenic
1040427513 8:47303678-47303700 GAACCATCTTTGCATCCCAAGGG + Intronic
1041101348 8:54399089-54399111 GTACCATCATTGCCCCCCACAGG - Intergenic
1041412122 8:57568125-57568147 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1042002812 8:64145396-64145418 CAACAATCCTTCGGTCCCACAGG + Intergenic
1043750098 8:83924086-83924108 CAACCATCCTTGCATCCCAGTGG + Intergenic
1044825806 8:96195700-96195722 GAACCATCTTTGGCTCCCTGAGG + Intergenic
1045145104 8:99334675-99334697 GAACCAGCCTTGCATCCCAGGGG + Intronic
1045150687 8:99403662-99403684 GACCCAACCTGGGCTGCCACTGG - Intronic
1048024872 8:130577114-130577136 GTTCCATGCTTGTCTCCCACCGG - Intergenic
1048040690 8:130725225-130725247 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1048693288 8:136992898-136992920 GAACCATCCTTGTATCCTATGGG + Intergenic
1049115531 8:140683673-140683695 GAACCAACCTTGCATCCCAGGGG - Intronic
1051081907 9:13303822-13303844 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1051085363 9:13342464-13342486 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1051113605 9:13668436-13668458 GAACTATCCTTGCATCCCAGGGG - Intergenic
1051489300 9:17643654-17643676 GAAGCAGCCTTGCATCCCACGGG + Intronic
1051571117 9:18560329-18560351 GAACCAGCCTTGCATCCCAGGGG + Intronic
1051846535 9:21457419-21457441 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1052547009 9:29892424-29892446 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1054142486 9:61540394-61540416 GAACACTCCTTGGCTTCCAGGGG - Intergenic
1054853302 9:69871266-69871288 GAACCATGCATGCCTCCCATAGG - Intronic
1055823418 9:80295662-80295684 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1056328095 9:85498288-85498310 AAACCATCCTTGCATCCCAGGGG - Intergenic
1057343048 9:94220557-94220579 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1058029630 9:100180949-100180971 GAACCAGCCTTGCATCCCAGGGG - Intronic
1060276001 9:122183051-122183073 GAACCTTACTGAGCTCCCACTGG - Intronic
1060739928 9:126091355-126091377 GAGCCATCACTGGGTCCCACAGG + Intergenic
1203754096 Un_GL000218v1:107993-108015 GAACCACCCTTGCATCCCAGGGG + Intergenic
1203537706 Un_KI270743v1:57522-57544 GAACCATCCTTGCATCCCAGGGG - Intergenic
1186866784 X:13728420-13728442 GAACCAGCCTTGCATCCCAGGGG - Intronic
1187248018 X:17570991-17571013 GAACCAGCCTTGCATCCCAGGGG + Intronic
1187787041 X:22903467-22903489 GAACCATCCTTGCATCCCAGGGG + Intergenic
1188315138 X:28664460-28664482 TAACCATCCTTGGCTTGCATTGG + Intronic
1188861831 X:35267352-35267374 GAACCATCCTTGCATCTCAGGGG + Intergenic
1190279938 X:48922910-48922932 GAACCATCCCTGCATTCCACAGG - Exonic
1190301633 X:49060535-49060557 GAACCTTCCTTTACCCCCACAGG - Intronic
1190530028 X:51365446-51365468 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1190551879 X:51591340-51591362 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1190791114 X:53701196-53701218 GAGCCATTCTTGGCTCTCAGAGG - Intergenic
1191195926 X:57722750-57722772 GAACCAACCTTGCATCCCAGGGG + Intergenic
1191747427 X:64504665-64504687 GAACCAACCTTGCATCCCAGGGG - Intergenic
1191948100 X:66557689-66557711 GAACCAGCCTTGCATCCCAGAGG - Intergenic
1192042718 X:67640138-67640160 GAACCAGCCTTGCATCCCAGGGG + Intronic
1192132172 X:68562098-68562120 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1192393988 X:70759438-70759460 GAACCAGCCTTGCATCCCAGGGG - Intronic
1192865462 X:75127228-75127250 GAACCAGCCTTGCATCCCAGGGG - Intronic
1193588541 X:83358403-83358425 GAACTATCCTTGTATCCCAGGGG - Intergenic
1194040469 X:88936025-88936047 GAACCAACCTTGCATCCCAGGGG + Intergenic
1194273888 X:91856314-91856336 GAACCATCCTTGTTTACCAGGGG + Intronic
1195103711 X:101582353-101582375 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1195117386 X:101713399-101713421 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1196639631 X:118043557-118043579 GAACCATCCTTGCATCCCTGGGG - Intronic
1198085996 X:133282783-133282805 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1199088843 X:143667228-143667250 GAACCTTCCTTGCATCCCAGAGG + Intergenic
1199178004 X:144815053-144815075 GAACCATCCTTGCATCCCTAGGG - Intergenic
1199325747 X:146495805-146495827 GAACCAACCTTGCATCCCAGGGG - Intergenic
1199327547 X:146516843-146516865 GAACCATCTTTGCCTCCCAAGGG + Intergenic
1199741012 X:150736300-150736322 GATCCTTCCTTGGCTGCCCCAGG - Intronic
1200578179 Y:4915364-4915386 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1200591125 Y:5077731-5077753 GAACCATCCTTGTTTACCAGGGG + Intronic
1201384907 Y:13429487-13429509 AAACCATCCTTGGTTCCCTAGGG + Intronic
1201497921 Y:14609533-14609555 GAACCAGCCTTGTATCCCAAGGG + Intronic
1201599892 Y:15716817-15716839 GAACCAGCCTTGCATCCCAGGGG - Intergenic
1201602289 Y:15744662-15744684 GAACCAGCCTTGCATCCCAGGGG + Intergenic
1201766622 Y:17579024-17579046 CAACCTTCCTGGGCTCCCGCAGG - Intergenic
1201834930 Y:18326960-18326982 CAACCTTCCTGGGCTCCCGCAGG + Intergenic