ID: 1147416802

View in Genome Browser
Species Human (GRCh38)
Location 17:40297473-40297495
Sequence TGTTGGGGGTGGAGGCCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 717
Summary {0: 1, 1: 0, 2: 13, 3: 92, 4: 611}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147416802 Original CRISPR TGTTGGGGGTGGAGGCCAAA GGG Intronic
901160081 1:7170460-7170482 TGTCGGGGTTGGAGGGCAAGGGG - Intronic
902822186 1:18950208-18950230 TGTTGGGGGTGGAGGGAGAACGG - Intronic
903017098 1:20368355-20368377 GGACGGGGGTGGAGGGCAAATGG - Intergenic
905863216 1:41363627-41363649 TGGTGGGGGTTGAGCCCAAGGGG - Intronic
905965584 1:42092683-42092705 TGTTGGAAGTGGGGGCCTAATGG - Intergenic
906287201 1:44595223-44595245 GGTAGGGGTGGGAGGCCAAAGGG + Intronic
906460914 1:46034715-46034737 TGTTGGGGGTGGGGGAGAAGGGG - Exonic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
907692901 1:56688220-56688242 GGTTAGGGGTGGGGGACAAAGGG + Intronic
907953991 1:59210808-59210830 TGTCGGGGGTGGTGGCCTAGGGG + Intergenic
907999371 1:59665603-59665625 GGTTGGGGGTAGAGGGCAAATGG - Intronic
908902186 1:68968447-68968469 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
909053448 1:70795534-70795556 TGTTGGGGGTAGGGGGCAAGGGG - Intergenic
909456556 1:75856433-75856455 TGTCGGGGGTGGAGGGCTAGGGG - Intronic
909541548 1:76797331-76797353 TGTTGGGGGTGGAGAACATCAGG + Intergenic
910925531 1:92394321-92394343 TGTGGGGGGTGGGGGGCTAAGGG + Exonic
910945624 1:92589126-92589148 TTTTGGGGGTGGAGCCAATATGG + Intronic
911724854 1:101232556-101232578 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
911860195 1:102937483-102937505 TGTTGGGGGTGGGGCCTAAATGG + Intronic
912170022 1:107088262-107088284 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
912720549 1:112016389-112016411 GGTTGGGGGGTGAGGCCAAGGGG - Intergenic
912798096 1:112704998-112705020 TGCTGGGGGTGGGGGACACATGG - Intronic
912919979 1:113856736-113856758 TGTAGGGGTTGAAGCCCAAAGGG - Intronic
913566751 1:120080256-120080278 TGTTGGAGGTGGGGCCCAATGGG + Intergenic
914287506 1:146240963-146240985 TGTTGGAGGTGGGGCCCAATGGG + Intergenic
914440389 1:147700354-147700376 TCTAGAGGGCGGAGGCCAAAGGG + Intergenic
914548538 1:148691705-148691727 TGTTGGAGGTGGGGCCCAATGGG + Intergenic
915245573 1:154553849-154553871 TGTTGGGGGTGTGGCCCAGAGGG + Intronic
917019941 1:170575204-170575226 TGTTGGGGGTGGGGGGCAAAGGG + Intergenic
917045798 1:170858844-170858866 TGTTGGGGGTGGGGCCTAATGGG + Intergenic
917768033 1:178244722-178244744 TGTTGGGGGATGAGGGGAAAGGG - Intronic
918142976 1:181733765-181733787 AGTTGGGGGTGGAGGGGAACAGG - Intronic
918248200 1:182679264-182679286 TGGTGGGAATGGAAGCCAAATGG - Intronic
918353218 1:183679382-183679404 TGTCGGGGGTGGGGGGCAAGGGG - Intronic
918412711 1:184276925-184276947 TGTTGGAGGTGGAGCCTAATAGG + Intergenic
918837373 1:189484507-189484529 TGTTGGGGGGTGGGGGCAAAGGG + Intergenic
918846305 1:189618707-189618729 TGTTGGGGGGTGAGGGGAAAGGG + Intergenic
919785417 1:201255162-201255184 AGTGGGGTGAGGAGGCCAAACGG - Intergenic
919829340 1:201529458-201529480 TGTTCAGAGTGGAGGCCTAATGG + Intergenic
920337802 1:205256959-205256981 GGGTGGGGGTGGGGGGCAAAGGG - Intronic
920510098 1:206544695-206544717 GGTTGGGGGTGTAGGCAGAAAGG - Intronic
920669828 1:207994968-207994990 TGTTGGGGGGTGGGGGCAAAGGG + Intergenic
920972483 1:210754485-210754507 TGTTGGAGGTGGGGGCCGATAGG + Intronic
920994059 1:210970260-210970282 TGTTGGGGGTGGGGGACAAGGGG - Intronic
921009026 1:211122821-211122843 TGTTGGGGGTGGGGGTAGAAGGG + Intronic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
921571493 1:216784730-216784752 TGTTGGGGGTTTGGGGCAAAAGG - Intronic
922898996 1:229121986-229122008 TGTTGGAGGTGGAGCCTAATGGG + Intergenic
923005644 1:230047318-230047340 TGTTGGAGGTGGAGACCAATGGG - Intergenic
923434705 1:233956925-233956947 GGATAGGGGTAGAGGCCAAATGG + Intronic
923472327 1:234303098-234303120 TGTTGGGGGTGGGGAAGAAAGGG - Intronic
923506116 1:234608466-234608488 TGTTGGGTTTCGAGGCCAACGGG - Exonic
923971216 1:239205196-239205218 TGTTGGAGGTGGAGCCTAACGGG + Intergenic
924356466 1:243182021-243182043 TGTTGGGAGGTGAGGCCTAATGG + Intronic
1063340056 10:5254190-5254212 TGTTGGAGGTGGAGTCTAATGGG - Intergenic
1063515756 10:6693483-6693505 TGTTGGAGGTGGAGTCTAATGGG + Intergenic
1063575644 10:7259682-7259704 TGTAGGGGGAGGAGACCACAAGG - Intronic
1064359906 10:14655244-14655266 TGTTGGAGGTGGGGACTAAAGGG - Intronic
1064816618 10:19272678-19272700 TGTGGTGGGTGGAGGGCAAGGGG - Intronic
1064978442 10:21142864-21142886 TGTTGGGGGTGGGGGGCAGGAGG - Intronic
1065244770 10:23746077-23746099 TGTTGGAGGTGGAGCCTAAGAGG + Intronic
1065764289 10:29012608-29012630 TGTTGGGGGTTAAGGCAAATGGG - Intergenic
1066577921 10:36847047-36847069 TGTTGGGGGTTGAGGGGCAAGGG - Intergenic
1067154079 10:43760410-43760432 GGTTGTGGGTGGGGGACAAAGGG + Intergenic
1069647055 10:70008066-70008088 TCTGGGGGGTGGAGGCAAGAAGG - Intergenic
1069914030 10:71776203-71776225 TCTTGGGGGTGGAGGGCATTGGG - Intronic
1071211375 10:83345410-83345432 CTTTGTGGGGGGAGGCCAAATGG + Intergenic
1071856929 10:89635483-89635505 TGTTGGGAGATGAGGCCTAATGG - Intronic
1072685393 10:97533579-97533601 TGGTGGAGGTGGGGGGCAAAGGG - Intronic
1073645319 10:105295717-105295739 TGTTGGGGGTGGAGGGAAGGGGG - Intergenic
1074140529 10:110668241-110668263 CCTTGGGTGGGGAGGCCAAAAGG + Intronic
1074737808 10:116453931-116453953 TGTTGGGGGTGGGGGACAAGGGG - Intronic
1075030861 10:119023816-119023838 GGTTGGGGGTGGGGGGCACATGG + Intergenic
1075354694 10:121760938-121760960 TGTTGGAGGTGGAGCCCAGTGGG + Intronic
1075865052 10:125711300-125711322 TGTTGGGGGTTGGGGCCTAATGG + Intergenic
1076494129 10:130885665-130885687 TGTTTGGGGTGGAGGGCCCATGG - Intergenic
1076647417 10:131962759-131962781 GGTTGGGGGTGGAGCCCAGCAGG - Intergenic
1077379225 11:2220941-2220963 TGTTGAAAGTGGAGGCCTAATGG - Intergenic
1077496780 11:2890489-2890511 TGATGTGGTTTGAGGCCAAAGGG - Intronic
1077776378 11:5276409-5276431 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
1078998918 11:16733573-16733595 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
1079101607 11:17545287-17545309 TGTTGGGGGTGGAGGTGTTAGGG - Intergenic
1079125430 11:17715006-17715028 GGTTGGGGGCGGAGGGAAAAAGG - Intergenic
1079173362 11:18116940-18116962 TGTTGGGAGTGGAGCCTAGAGGG + Intronic
1079233644 11:18671405-18671427 TGTGGGGGTTGGAGGCCAGGTGG + Intergenic
1079263170 11:18903423-18903445 TGTCGGGGGTGGGGGGCAAGGGG + Intergenic
1079344214 11:19637789-19637811 TGTTGGGGGTGGGGCCCAGTGGG - Intronic
1079863547 11:25705896-25705918 TGTTGGGGGTGGAGGTCAAGGGG - Intergenic
1080435558 11:32238639-32238661 TGTTGGAGGTGGAGCCTAATGGG + Intergenic
1080512954 11:32993381-32993403 TGTTGGGAGTGGGGGCTTAATGG - Intergenic
1080586426 11:33686875-33686897 TGTTGTGGGGGCAGGCAAAATGG - Intergenic
1080670716 11:34374133-34374155 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1080848343 11:36045959-36045981 TGTTGGGGGTGGGGGACGAAGGG - Intronic
1081795384 11:45815693-45815715 TGTTGGAGGTGGGGACCTAATGG - Intergenic
1082699480 11:56409987-56410009 TGTTGGGGGTGTAGCCCTCATGG + Intergenic
1082776403 11:57248118-57248140 GGTGGGGGGTGGAGGGCAAGGGG + Intergenic
1083279718 11:61619371-61619393 TCCTGGGGGTGGAGGCCTCAGGG + Intergenic
1083319087 11:61834407-61834429 AGTTGGGGCTTGAGGCCTAAGGG + Intronic
1083459218 11:62799681-62799703 TGCTGGGCGTGGAGGCCACGGGG - Intronic
1083507563 11:63173213-63173235 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1083582981 11:63837183-63837205 GGTTGGGGATGAAGGTCAAAGGG + Intergenic
1084436616 11:69145829-69145851 TGTTGGGGGTTGTGGCCAGAGGG - Intergenic
1084595781 11:70116228-70116250 TCCTGGTGGTGGAGGCCAACAGG + Intronic
1084764950 11:71302122-71302144 TCTTGGGGGTGGGGGACACAGGG + Intergenic
1084893787 11:72250744-72250766 TGCTGAGGGTGGAGGCTGAAAGG - Intergenic
1085232224 11:74982227-74982249 TTTTGGGGGTGTAGGCCATAAGG - Intergenic
1085348628 11:75784059-75784081 TGTTGGGGGTGGGGGCAAGAGGG + Intronic
1085681282 11:78577484-78577506 TGTTGGGAGATGAGGCCTAATGG + Intergenic
1087076095 11:94128599-94128621 TGTTGGGGGTGGGGCGTAAAGGG + Intergenic
1087350138 11:97020600-97020622 TGGTGGTGGTGATGGCCAAAGGG + Intergenic
1087369649 11:97266640-97266662 TGTTGGAGGTGGAGCCTAACGGG - Intergenic
1087391709 11:97543041-97543063 GTTGGGGGATGGAGGCCAAAGGG + Intergenic
1087686247 11:101268977-101268999 TGTTGGGGGTGGTGGGCAAGGGG - Intergenic
1087710547 11:101544725-101544747 TGTTGGGGGTGGCGGGCTAGGGG + Intronic
1087732302 11:101792783-101792805 TGGTGAGGGTGGGGGCAAAAGGG - Intronic
1087749818 11:101995019-101995041 TGTCGGGGGTGGAGGGCTAGGGG - Intronic
1087937064 11:104046886-104046908 TGTCGGGGGTGGAGGGCTAGGGG - Intronic
1088111707 11:106268663-106268685 TGTTGGGAGTGGAGGGCAAGGGG - Intergenic
1088203108 11:107361807-107361829 TGTTGGGGGAGGAGCCAAGATGG + Intronic
1089022345 11:115229341-115229363 TGTTGGGGTTAGAGGACAGAGGG - Intronic
1089055894 11:115584516-115584538 GGTTGGGGCTGGAGGCCAGGGGG + Intergenic
1089268124 11:117281673-117281695 TGATGGGGGTGGAGGTAAAGTGG - Exonic
1090166633 11:124555836-124555858 TGTTGGGGGTTGAGGGGCAAGGG - Intergenic
1090451057 11:126806828-126806850 TGTTGGGGGTGGGGGGCAAGGGG - Intronic
1090711473 11:129390250-129390272 TGTGGTGGGTGGGGGCCAAGTGG + Intronic
1091166944 11:133486904-133486926 TGTAGGGGGTGGAGGGGAAGAGG - Intronic
1091235894 11:134021803-134021825 TGTTGGGGGTGGTGGGGAAGGGG + Intergenic
1091642930 12:2251221-2251243 TCATGGGGGTGAAGGGCAAAGGG + Intronic
1091665115 12:2413398-2413420 TGTTGGGGGAGGGGGCCTATGGG - Intronic
1091951737 12:4598577-4598599 AGATGGGGGCTGAGGCCAAAGGG - Intronic
1092236832 12:6815746-6815768 TCTAAGGAGTGGAGGCCAAATGG + Intronic
1092284591 12:7121485-7121507 TGTGGGAGGTGGAGGCCGAGGGG + Intergenic
1092452153 12:8612896-8612918 TGTCAGGGGAGGAGCCCAAAAGG - Intergenic
1092744976 12:11664834-11664856 TGTTGGGGGTGGGGACAAAATGG - Intronic
1092985210 12:13838540-13838562 TGTAGGAAGTGGAGGCCAGAAGG - Intronic
1093227922 12:16507816-16507838 TGTTGGGGGAGGGGGCTAATGGG - Intronic
1093412288 12:18881063-18881085 TCTTGCGGGTGGAGCCCACATGG - Intergenic
1093831041 12:23758725-23758747 TGTTGGGAGGTGAGGCCTAATGG + Intronic
1095931672 12:47632380-47632402 TGTTGGAGGTGGAGGCTAGTGGG - Intergenic
1096754189 12:53785219-53785241 TGTTGGGGGAGGAGGTCTAAAGG - Intergenic
1096879836 12:54658607-54658629 TGTTGGGGTTGGGGGGAAAAGGG - Intergenic
1097922987 12:65096860-65096882 TGTTAGGAGTGGAGGGCAAGGGG + Intronic
1098929762 12:76397537-76397559 TGTTGTGGGTAGAGGCAGAATGG + Intronic
1099431445 12:82591157-82591179 TGTTGGGGGTGGAGGGCTACAGG + Intergenic
1099561020 12:84174073-84174095 TGGAGGGGGTGGAGGCAGAAGGG + Intergenic
1100317197 12:93455262-93455284 TGTCGGGGGTGGGGGGCAAGGGG - Intergenic
1100591377 12:96033703-96033725 TGTTGGGGGTAGGGGCCTAGGGG - Intronic
1101706612 12:107226376-107226398 TGGTGGGGGTGGGGGGCAAAGGG - Intergenic
1102515431 12:113443050-113443072 TGATGGGGACTGAGGCCAAATGG + Intergenic
1102568209 12:113811108-113811130 TGTTGGGGGTGGAGGGCTAAGGG - Intergenic
1102803776 12:115761320-115761342 AGCTGGGGGTGGAGGAGAAAAGG - Intergenic
1102846965 12:116195261-116195283 TGGTGGGGGTGGGGGCAACAGGG + Intronic
1105260164 13:18773172-18773194 GGTTGGGGGTGGAAGGAAAAGGG - Intergenic
1105584051 13:21727305-21727327 TGTTGGTAGTGGAGGCCACAAGG + Intergenic
1105813873 13:24016206-24016228 TGTGAGGGGTGGAGGCCAGTGGG + Intronic
1106190648 13:27449967-27449989 TGTTGCGGGAGGAGGCCTTATGG - Intronic
1106617201 13:31340588-31340610 TTTTGGGGGTGGAGCCAAGATGG + Intergenic
1106667792 13:31870750-31870772 TGTTGGAGGTGGGGCCTAAAAGG - Intergenic
1106706178 13:32282151-32282173 GTTTTGGGTTGGAGGCCAAATGG - Intronic
1107620390 13:42223107-42223129 TGTGGGGGGTGGATGAGAAAAGG + Intronic
1107707628 13:43123080-43123102 TTGTGGGGATGGAAGCCAAATGG + Intergenic
1108155108 13:47576667-47576689 TGTTGGAGGTGGAGGCTAGTGGG - Intergenic
1109004721 13:56857476-56857498 TGTGGGGGGTGGGGGACAAGGGG + Intergenic
1109371642 13:61428480-61428502 TGTTGGAGGTGGAGCCTAACGGG - Intergenic
1110458004 13:75711740-75711762 TGTAGGGGGTGGAGCCAAGATGG - Intronic
1110874720 13:80494387-80494409 TGTTGGAGGTGGATGCCTCATGG + Intergenic
1111835835 13:93387320-93387342 TGTTGGGGGTGGAGGGGAAGGGG - Intronic
1111956176 13:94761031-94761053 AGCTGGGAGTTGAGGCCAAAAGG + Intergenic
1112071598 13:95858046-95858068 TGTTGGTGGTGGAGGGCAAATGG + Intronic
1113046714 13:106164051-106164073 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1113501855 13:110782092-110782114 TGTAGGGGGTGGAGCCCTCATGG - Intergenic
1113574878 13:111388296-111388318 TGTTGAGGCTGTAGGCCAAGGGG - Intergenic
1113720947 13:112555796-112555818 TGTGGAGGGAGGAGGCCACATGG + Intronic
1114797365 14:25731750-25731772 TGTCGGGGGTGGAGGGCTAGGGG - Intergenic
1115133956 14:30086707-30086729 TGTTGCTGGTGGTGGCCACAGGG + Intronic
1115796649 14:36944382-36944404 GGTTGCGGGTGGAGGGCATAGGG + Intronic
1115977393 14:39012114-39012136 TGTTGGAGGTGGGGCCTAAAGGG + Intergenic
1116028184 14:39538474-39538496 TCTTGGGGGTGGAGCCCCCAGGG + Intergenic
1116466482 14:45239252-45239274 GGTTGGGGGTGGAGGCAAGCAGG + Intronic
1116553094 14:46267284-46267306 TGTCGGGGGTGGGGGGCTAAGGG + Intergenic
1116795992 14:49390565-49390587 TGTTGGGGGTTGGGGGAAAAGGG + Intergenic
1117399346 14:55344708-55344730 TGGTGGGGGTGGAGGACAAGGGG - Intronic
1118370472 14:65133394-65133416 AATTGGGGGTGAAGGACAAAGGG - Intergenic
1118410529 14:65472387-65472409 TGTTGGGGGTGGGGCCTAATGGG - Intronic
1118496732 14:66314970-66314992 TGTTGGGGGTGGGGAGCAAGTGG - Intergenic
1119110687 14:71971161-71971183 ACTTGGGTGTGGAGGCCCAAAGG - Intronic
1120001077 14:79303629-79303651 TGTTGGGGGTGGGGGGCTAAAGG + Intronic
1120076713 14:80167423-80167445 TGTTGTGCGTGGATACCAAAGGG - Intergenic
1120101011 14:80445680-80445702 TGTTGGAGGTGGGGCCTAAAGGG + Intergenic
1120115279 14:80609459-80609481 GGATGGGGGTGGGGGCCAGAGGG - Intronic
1120278849 14:82413475-82413497 TGTTGGGAGGTGAGGCCTAATGG + Intergenic
1120284421 14:82480249-82480271 TGTTGGAGGTGGAGCCTAATGGG + Intergenic
1120389184 14:83883742-83883764 GGTTGGGAGTGGAGGCTAGATGG - Intergenic
1120621436 14:86769748-86769770 TCGTGGGGGTGGGGGCCTAAGGG + Intergenic
1120905359 14:89616200-89616222 GGTTGGGGGTGGAGGCTAGGGGG + Intronic
1121488687 14:94342291-94342313 TGTTGGAGTTGGGTGCCAAAAGG + Intergenic
1121774896 14:96584162-96584184 TGTTCTGGGAGGAGGCCACAAGG - Intergenic
1121986822 14:98515003-98515025 GGGTGGGGGTGGAGGCTGAAAGG - Intergenic
1122370224 14:101225482-101225504 TGGTGTGGGTGGGGCCCAAAGGG - Intergenic
1122837129 14:104435824-104435846 TCTTGGGGGTAGAGTGCAAAGGG - Intergenic
1123024609 14:105418927-105418949 TGTTGGGGGAGGTGAGCAAAAGG - Intronic
1123400993 15:19986235-19986257 TGTTGGGGGTGGGGGGCAAGAGG + Intergenic
1123751906 15:23363651-23363673 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124284272 15:28387575-28387597 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124298425 15:28524039-28524061 GGGTGGGGGTGGTGGCCAGAGGG + Intronic
1125181819 15:36887454-36887476 AGGTGGGGGTGGGGGCGAAAGGG + Intergenic
1125363889 15:38893012-38893034 TGTTGGGGGTGGGGGGCAGGGGG + Intergenic
1125420525 15:39500005-39500027 TGCTGGAGGGGGAGGCCACATGG - Intergenic
1126519323 15:49573471-49573493 TGTTGGGAGATGAGGCCTAATGG + Intronic
1126885164 15:53141457-53141479 TGTTGGGGGAGGAGCCAAGATGG - Intergenic
1127187399 15:56493680-56493702 TGTTGGGTGATGAGGCCTAATGG - Intergenic
1127366930 15:58299847-58299869 TGCAGGGGATGGAGGCCACAAGG + Intronic
1127463225 15:59218990-59219012 TATTTGGGCTGGAGGCAAAAGGG + Intronic
1127552110 15:60050648-60050670 TGTTGGGAGATGGGGCCAAATGG + Intronic
1127568082 15:60213167-60213189 GGGTGGGGGTGGAGGGCAAGGGG + Intergenic
1129576086 15:76747549-76747571 TGTTGGAGGTAGAGGCCTAATGG + Intronic
1130792846 15:87174443-87174465 TGTTGGAGGTGGGGCCCTAATGG + Intergenic
1131266699 15:90919706-90919728 TGTTGGACGGGGAGGCCAGAGGG - Exonic
1131619597 15:94053681-94053703 TGTTGGAGGTAGGGGCCTAATGG + Intergenic
1131994247 15:98119125-98119147 TCTTGGGGGTGGTGGGCAGAGGG + Intergenic
1132015634 15:98314034-98314056 TGTCGGGGGTTGAGGGGAAAAGG - Intergenic
1132826815 16:1909310-1909332 TGATGTGGGTGGAGGGGAAAGGG - Intergenic
1133389801 16:5400775-5400797 TGTTGGGGGTGGGGAAGAAAAGG - Intergenic
1133492337 16:6282532-6282554 TGTCGGGGGTGGTGGGCAATGGG - Intronic
1133845472 16:9449306-9449328 GGTTGGGGGTGGAGGAAAGATGG + Intergenic
1134373581 16:13649085-13649107 TGTTGGGGGGTGAGGGGAAAGGG - Intergenic
1134813648 16:17188223-17188245 AGTTGGGAGTGGGGCCCAAATGG - Intronic
1134859469 16:17548281-17548303 TGTTGGGGGTGACGGATAAAAGG - Intergenic
1135528076 16:23229185-23229207 TATAGGGGTTGGAGGCCAAAAGG + Intergenic
1135872833 16:26166761-26166783 TGATGGGTGTGTGGGCCAAATGG - Intergenic
1135948070 16:26882962-26882984 TGTTGGGGGTGGGGGACAAAAGG + Intergenic
1136411992 16:30083003-30083025 TGATGGGGGTTGAGGCCAGCGGG + Intronic
1137552196 16:49445322-49445344 TGCTGGAGGTGGAGGCCTTAGGG - Intergenic
1138059731 16:53877557-53877579 GGTTGGGGGTGACTGCCAAATGG + Intronic
1138175974 16:54898587-54898609 TTGTGGGGGTGGAGGGCAAGGGG - Intergenic
1138520036 16:57565806-57565828 TGTTGGGGGTGGGGGCAGAGTGG + Intronic
1138584848 16:57962947-57962969 TGCTGGGGCTGGAGGCTGAAGGG - Intronic
1138741191 16:59312739-59312761 TGTCGGGGGTGGTGGGGAAAAGG - Intergenic
1138770257 16:59654194-59654216 TGTTGGAGGTAGGGGCCTAATGG - Intergenic
1138929614 16:61636541-61636563 TTTTGGGGGTGGGGGACTAAGGG + Intergenic
1139254202 16:65525385-65525407 TGCTAGGGCTGGAGCCCAAAAGG + Intergenic
1141119918 16:81345591-81345613 TGTTAGGGGTGGGGGCCTAGGGG + Intronic
1141334446 16:83141663-83141685 TGTTGGGGGTTGGGGACAAAAGG - Intronic
1142285232 16:89168903-89168925 TGTGGGGCGTGGAGGGCAGAAGG - Intergenic
1142286491 16:89173513-89173535 TGGTGGAGGTGGGGGCCAGATGG + Intronic
1142670388 17:1485296-1485318 GATTGGGGGTGGATCCCAAAGGG + Intronic
1143771012 17:9168842-9168864 TGTGGGGGGTGCAGGGAAAAGGG + Intronic
1143872006 17:9963926-9963948 TCTAGGGGGTGGAGGGCAAGGGG + Intronic
1144012096 17:11158932-11158954 TGTTGGGGGTGGAGTGTAAAGGG + Intergenic
1144462669 17:15470252-15470274 ACTTGAGCGTGGAGGCCAAAGGG - Intronic
1144503112 17:15806798-15806820 TGTTGAGGTTCCAGGCCAAAGGG + Intergenic
1144801001 17:17927209-17927231 CAATGGGGGTGGAGTCCAAAGGG + Intronic
1145165293 17:20609504-20609526 TGTTGAGGTTCCAGGCCAAAGGG + Intergenic
1145713701 17:26999127-26999149 TGTTGGAGGTGGGGCCTAAAGGG + Intergenic
1147416802 17:40297473-40297495 TGTTGGGGGTGGAGGCCAAAGGG + Intronic
1148580231 17:48738503-48738525 AGATGGGGGTGGAGGATAAAGGG - Intergenic
1148895490 17:50836841-50836863 TGATGGGGGTGGGAGCCACAGGG + Intronic
1148906071 17:50913114-50913136 TGTGGGGAGTGGAGGGCACAAGG - Intergenic
1148934924 17:51157484-51157506 TGTTGGGAGGTGAGGCCTAATGG - Intronic
1149066845 17:52490649-52490671 TGATGGAGATGAAGGCCAAATGG + Intergenic
1151681642 17:75625687-75625709 GGTGGGGGCTGGAGGCCAAGAGG + Intergenic
1152709243 17:81862066-81862088 TGTAGGGGCTGGAGGACAGAAGG + Intergenic
1153082863 18:1248519-1248541 TGTTGGAGGTGGGGCCCAATGGG - Intergenic
1153463366 18:5362060-5362082 TGTTGGGGGTGGGGAGCAAAGGG + Intergenic
1153990575 18:10395437-10395459 TGTTGGGGGTGGGGCCTAATGGG + Intergenic
1154425863 18:14271628-14271650 GGTTGGGGGTGGAAGGAAAAGGG + Intergenic
1154433552 18:14326870-14326892 GGTTGGGGGTGGAAGGAAAAGGG + Intergenic
1154982693 18:21516706-21516728 TGTTCAGGTTGGAGGGCAAAGGG + Exonic
1155493809 18:26423892-26423914 GGTGGGAGGTGGCGGCCAAAGGG + Intergenic
1155509998 18:26566851-26566873 AGTTGGGGGTGGGGGCAAACAGG + Intronic
1156083797 18:33375020-33375042 TGTTTGGGGTGGTGGTTAAATGG + Intronic
1156179204 18:34583323-34583345 GTTTGGGGGTGGGGGCCAACGGG - Intronic
1156504749 18:37582717-37582739 TGATGGGGATGGAGGGAAAATGG - Intergenic
1156516688 18:37686146-37686168 TGGTGGGGGTGGGGGCAAATGGG + Intergenic
1157480571 18:48051077-48051099 TGTTGGGGCTGGAGGTCAACAGG - Intronic
1157574464 18:48734213-48734235 TGCTGGGGGTGGGGGACAGAAGG - Intronic
1158290100 18:55931368-55931390 TGTTGGAGGTGGAGCCTATAAGG + Intergenic
1158390757 18:57043124-57043146 TGTCGGGGGTGGAGGGCAAGGGG + Intergenic
1158767653 18:60474242-60474264 TGTTGGGTGTGGGGGACAAGGGG + Intergenic
1159254979 18:65933593-65933615 TATTGGGAGTGGAGGGCAAGAGG + Intergenic
1160255787 18:77247624-77247646 TGTTGGAGGTGGAGCCCAGTGGG - Intergenic
1160268547 18:77362865-77362887 TGTTGTGGGAGGAGCCCAATAGG - Intergenic
1160791977 19:927286-927308 GGGTGGGGGTCGAGGACAAAGGG + Intronic
1160906882 19:1455796-1455818 GGTTCTGGGTGGAGCCCAAATGG + Intronic
1161149768 19:2701799-2701821 TGTTGGGGGTTGAGGTTAATTGG - Intronic
1161588790 19:5119438-5119460 TGTTGGGAGGAGAGACCAAAGGG - Intronic
1161949285 19:7458846-7458868 TGTTGGACGTTGAGGCCAACGGG + Intronic
1163199037 19:15749328-15749350 TATTGGGAGTGGAGGCTAATTGG + Intergenic
1163888175 19:19988027-19988049 TGGTGGGGGTGGGGCCCAGATGG + Intergenic
1164460024 19:28438822-28438844 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
1164940921 19:32251862-32251884 TGTTGGGGGGCGAGTCCGAAGGG - Intergenic
1164983036 19:32628368-32628390 TGCTGGGTGTGGAGGCCTAAAGG - Intronic
1165330675 19:35139793-35139815 TGCGGGAGGTGGAGGCCCAAGGG + Intronic
1165346207 19:35250003-35250025 TGTTGTGGGTGAATGGCAAAGGG + Intronic
1165425395 19:35742687-35742709 TGTTGGGGGTGAAGGGTAAGGGG + Exonic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1166365587 19:42276765-42276787 TGTTGGGGGTTGTGGGCATATGG - Intronic
1166809966 19:45508807-45508829 TCCTGGGGGTGGCGGCCCAAGGG + Intronic
1167018913 19:46860406-46860428 TTTTGGGGGTGGGGGGCGAAGGG - Intergenic
1167198675 19:48048852-48048874 TGTTGGAGGTGGGGCCCAGAGGG + Intronic
1167428633 19:49442239-49442261 TGTGGGGGGCGGAAGCCAGAGGG - Intronic
924985204 2:264253-264275 TGTTGGGGGTGGGGGTCTCAGGG + Intronic
927116991 2:19914932-19914954 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
927146389 2:20169083-20169105 TGTGGGGAGTGGAGGCCTAGAGG - Intergenic
927447834 2:23181055-23181077 TGTTGGAGGTGGAGCCTAGAGGG + Intergenic
927557940 2:24049417-24049439 TGTGGGGGGTGGGGGGCAGAAGG - Intronic
928099766 2:28429956-28429978 TGTGGGTTGTGGAGGCCACAGGG + Intergenic
928316620 2:30251448-30251470 TGTTGGGACTGGAGGCCACCAGG + Intronic
929064195 2:37956801-37956823 TGTTGGGGGTGGGGAGCAAGGGG - Intronic
929257181 2:39825133-39825155 TGTTGGGGGTGGGGGGCTAAGGG - Intergenic
929562139 2:42962537-42962559 GGTTGGGGGAGGAGGGCAAGCGG + Intergenic
929649781 2:43666482-43666504 TGTTGGGGGAGGAGCCAAGATGG - Intronic
929854183 2:45621918-45621940 GGTTGGGGGTGGAGGGTCAAGGG - Intergenic
930602443 2:53457748-53457770 AGTTGGGGGTAGAGGTGAAATGG - Intergenic
932045940 2:68349954-68349976 TGTTGGGGTTGGGGGGCAAGGGG + Intergenic
932155149 2:69409844-69409866 TGTTGGAGGTGGAGTCTAATGGG - Intronic
932513785 2:72323830-72323852 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
932780525 2:74555963-74555985 TGCTGAGGGTGGAGGCTGAAAGG + Exonic
933423183 2:82077873-82077895 TGTTAGGGGTGGAGCCTAAAGGG - Intergenic
934035931 2:88088449-88088471 AGTTGGGAGGGGAGGCCAAGAGG + Intronic
934492630 2:94771992-94772014 TGGTGGTGGTGGAAGGCAAAAGG - Intergenic
935506443 2:103910596-103910618 TGTTGGGGTTGGGGGCCTAGGGG - Intergenic
937083311 2:119155874-119155896 AGTTGTGGGTGGAGGTCAGAGGG - Intergenic
938301355 2:130216096-130216118 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
939473292 2:142652969-142652991 TGTCGGGGGTAGGGGGCAAAGGG - Intergenic
939941259 2:148354257-148354279 GGTGGGGGGTGGAGGGCAAGGGG - Intronic
940417544 2:153440096-153440118 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
940786631 2:157988612-157988634 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
940950467 2:159666924-159666946 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
941379422 2:164775220-164775242 GGTTGGGGGTGGTAGCCAGATGG - Intronic
941484520 2:166062941-166062963 AGTTGGTGGTGGAGGAGAAAAGG + Intronic
941501857 2:166289331-166289353 TGTCGGTGGTGGGGGGCAAAGGG - Intronic
942108617 2:172658149-172658171 TGTTGGAGGTGGAGCCTAATGGG - Intergenic
942200473 2:173565893-173565915 TGTTGCGGGTGGAGGACTAGGGG + Intergenic
944082177 2:195800191-195800213 TGTTGGGAGGAGAGGCCTAATGG - Intronic
944680546 2:202073125-202073147 GGATGGGGGTGGGGGTCAAATGG - Intergenic
945667085 2:212756646-212756668 TGTTGGGGGTGCAGCCAAGATGG + Intergenic
946091277 2:217226066-217226088 TGATGAGGATGGAGGTCAAAGGG + Intergenic
1168977287 20:1976763-1976785 TGGTGGGGGTTGGGGCCAACTGG - Intergenic
1169594129 20:7178615-7178637 GGTTGTGGGTGGGGGCCAAGAGG - Intergenic
1169751277 20:8997261-8997283 TGTTGGAGGTGGAGCCCAGTGGG + Intergenic
1170328017 20:15177363-15177385 TGTTGGGGGTGGAGTGGAAAGGG + Intronic
1170486876 20:16826810-16826832 TGTTGGGGGTTGGGGGCAAGGGG + Intergenic
1170671247 20:18435590-18435612 TGTCGGGGGTGGGGGGCAAGAGG + Intronic
1170803419 20:19609562-19609584 TGTTGGAGGTGGGGGGCAAGGGG - Intronic
1170853715 20:20028333-20028355 TGTCGGGGGTGGGGGTCTAAGGG + Intronic
1172058177 20:32168679-32168701 TGTTGGAGGTGGAGCCTAATGGG + Intergenic
1173265471 20:41475667-41475689 TGTTGGTGGTGGAGGGTAGAGGG - Intronic
1173859273 20:46271569-46271591 TGTTGGGAGTAGAAGCCAGATGG - Intronic
1174095124 20:48082773-48082795 TGTTGGAGGTGGGGCCCAATGGG - Intergenic
1174095941 20:48089510-48089532 GGCTGGGGTAGGAGGCCAAAGGG - Intergenic
1174894355 20:54433166-54433188 TGTTGGGGGAGGAGGGAAGAAGG - Intergenic
1175764480 20:61583067-61583089 TGTTTGTGGTGGAGGTCAGAGGG + Intronic
1175905369 20:62376908-62376930 TCTTGGGAGTGGGGGCCAAGCGG - Intergenic
1176417186 21:6483439-6483461 TGATGTGGGTGGTGGGCAAATGG - Intergenic
1176417196 21:6483493-6483515 TGATGTGGGTGGTGGGCAAATGG - Intergenic
1176691476 21:9916307-9916329 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
1176691505 21:9916471-9916493 TGTAGGGGGTGGGGGCCTAGGGG - Intergenic
1176991928 21:15507625-15507647 TGTTGGGAGGTGAGGCCTAATGG + Intergenic
1177186332 21:17801690-17801712 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
1177403997 21:20642523-20642545 TGTTGGGGGTCGGGGGCAAGGGG + Intergenic
1177924701 21:27199571-27199593 TCTTGGGGGTGGAGCCCTCATGG + Intergenic
1178067925 21:28926724-28926746 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
1178892608 21:36532688-36532710 TGGTGGGGTTGAACGCCAAAAGG + Intronic
1179057067 21:37946095-37946117 TGTTGGAGGTGGAGCCCAGTGGG + Intergenic
1179692683 21:43091772-43091794 TGATGTGGGTGGTGGGCAAATGG - Intergenic
1179692693 21:43091826-43091848 TGATGTGGGTGGTGGGCAAATGG - Intergenic
1180007587 21:45030111-45030133 AGTCGGGGGCCGAGGCCAAAAGG - Intergenic
1181305795 22:21916581-21916603 TGGGGGGGGGGGAGGCCCAAGGG - Intergenic
1181473046 22:23152545-23152567 TGCTGGGGGAGGTGGCCAAAGGG - Intronic
1181893186 22:26082929-26082951 AGATGGGAGTGGAGGGCAAATGG - Intergenic
1182221220 22:28760516-28760538 TGTTGGGGGTGGCGGACAGGGGG - Intergenic
1182351346 22:29701780-29701802 TGGAGGGGATGGAGGCCACAGGG - Intergenic
1183199416 22:36375509-36375531 TGGTGAGGGTGGAGGCCTCAAGG + Intronic
1183496971 22:38152076-38152098 TGTTGGAGGTGGGGGGCTAATGG + Intronic
1183787327 22:40037498-40037520 TGTTGGGAGCGGAGGCATAAAGG - Exonic
1184038086 22:41927992-41928014 AGATGGGGGTGAAGGCCAAAGGG + Intergenic
1184067036 22:42126910-42126932 TGTTCGGGGTGGAAGCGGAAGGG + Exonic
1184069762 22:42140614-42140636 TGTTCGGGGTGGAAGCGGAAGGG + Intergenic
1184071504 22:42150222-42150244 TGTTCGGGGTGGAAGCGGAAGGG + Intergenic
1184264426 22:43339554-43339576 TGTTGGGGGAGTAGGACAGACGG - Intronic
1185160663 22:49227417-49227439 GGTTGGGGGTGTAGGCAAAATGG + Intergenic
1185189374 22:49424673-49424695 TGGTGGGGGTGGAGGTCTCAAGG - Intronic
1185286599 22:50003018-50003040 TGGTGGGGGTGGATCCCAAGTGG + Intronic
949141164 3:634850-634872 TGTTGGAGGTGGAGCCCAATGGG - Intergenic
949203602 3:1411138-1411160 TGTTGGGGGTGGGGGACAAGGGG - Intergenic
950170155 3:10833376-10833398 TGTAAGGGGTGGAGGCCCGAGGG + Intronic
950196817 3:11015206-11015228 TGTGGGGGGTGGGGGCAAAATGG + Intronic
950590208 3:13931641-13931663 TGGTGGTGGTGGAGGTCGAAAGG - Intergenic
951555507 3:23917103-23917125 AGGTGGGGGAGGAGCCCAAAAGG + Exonic
951977299 3:28526951-28526973 TGTTGGGGGTGGGGGGCTAGGGG - Intronic
952284035 3:31950648-31950670 TGTTGGAGGTGGAGCCTAAGGGG + Intronic
952346039 3:32486752-32486774 TGTTGGGGGTGGAGCCTAGCTGG + Intronic
952728791 3:36618067-36618089 TGTTGTGGGTGGAGGAGACAAGG - Intergenic
953000509 3:38928367-38928389 TGTTGGGGGTGGGGAGCAAGGGG + Intronic
954133036 3:48569733-48569755 TGTTGGGAGTGCAGGACTAAAGG - Exonic
954138891 3:48594996-48595018 TGTTGGGGATGAAGGCCGAGTGG + Intronic
954146838 3:48638753-48638775 TGCTGGGGGTGGGGACCAGAGGG - Intronic
955586680 3:60485647-60485669 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
956453300 3:69395011-69395033 TGTCGGGGGTGGAGGGCAAGGGG + Intronic
956789194 3:72667838-72667860 TGTGGAGTGTGGATGCCAAATGG - Intergenic
958720176 3:97834086-97834108 TGTTGGAGGTGGGGCCCAATAGG - Intronic
959176518 3:102919771-102919793 TGTCGGGGGTGGGGGGCAAGGGG - Intergenic
960448499 3:117777977-117777999 TGAGGGGGGTGGAGCCAAAATGG + Intergenic
960676686 3:120202301-120202323 TGTTGGGGGTTGGGGGCAAGGGG - Intronic
961386216 3:126524703-126524725 TGTGGGGGGTAGAGGACAATTGG + Intronic
961662554 3:128477379-128477401 TGTAGGGGGTGGAGGCCAGGGGG + Intergenic
962467494 3:135673968-135673990 TGTTGGGGGTGGCGCCTAATGGG - Intergenic
963399911 3:144785441-144785463 GTTTGGGGGTGGAGGACAAGGGG - Intergenic
964377428 3:156063058-156063080 TGTCGGGGGTGGAGGGCAAGGGG - Intronic
964463632 3:156966139-156966161 TGATGGGGGTGGAGCCAAGATGG + Intronic
964653060 3:159033495-159033517 TGTTGGGGGTGAAGGGCTAAGGG - Intronic
965110967 3:164421660-164421682 TTTTGGGGGTGGAGGGTAAAGGG - Intergenic
965447522 3:168793903-168793925 TGTTGGGGGTGGGGGTCAAGTGG + Intergenic
965888790 3:173483787-173483809 TCTTAGGGGTGTGGGCCAAATGG - Intronic
965895417 3:173570085-173570107 TCTTGGGAGTGGGGGCCAGAAGG + Intronic
966344937 3:178968755-178968777 TGTTGGGACTGGAGGTCAATAGG - Intergenic
966948161 3:184792266-184792288 TGGTGGGGGTTGAGGCCAGCTGG - Intergenic
967376464 3:188808827-188808849 TGTTGGGGGATGGGGGCAAAGGG - Intronic
967707269 3:192665601-192665623 TTTTGGGGGTGGGGGGCAAGGGG + Intronic
967876313 3:194270606-194270628 TGTGAGGGGTGGAGGCGGAAAGG - Intergenic
968016544 3:195339700-195339722 TGTTGGGGGTGGTGGGCATGAGG + Intronic
968348226 3:198029786-198029808 TGTTGGGGGTGGAGGAGTCAGGG + Intronic
969566771 4:7983346-7983368 TGTTGGGGGAGGAAACCACAGGG + Intronic
970058448 4:12001574-12001596 TGTTGGAGGTGGGGCCCAACGGG - Intergenic
970354580 4:15239192-15239214 TGTTTGGGTTGGGGGACAAATGG + Intergenic
970654831 4:18219455-18219477 TGTTGGGGGTGGGGGCCAGGGGG - Intergenic
971431707 4:26574780-26574802 TGTTGGAGGTGGAGCCTAAATGG - Intergenic
972009498 4:34158891-34158913 TGGTGGTGGTGGTGGCCACAGGG + Intergenic
972115572 4:35628973-35628995 TGATGGGGGAGGAGGCCACATGG + Intergenic
972739602 4:41877812-41877834 GGGTGGGAGTGGGGGCCAAAAGG - Intergenic
972970347 4:44567021-44567043 TGTTGGGGGGTGGGGCCAAGGGG + Intergenic
973605574 4:52584064-52584086 TGTTGGGAGGTGAGGCCTAAAGG + Intergenic
973619265 4:52711491-52711513 TGTTGGGGGTGGAGCAGGAAGGG - Intergenic
973651683 4:53003082-53003104 TGTTGGTGGTGGGGCCCAATGGG - Intronic
973898594 4:55443024-55443046 TGTTGGGGGAGGGGGCATAATGG - Intronic
974006418 4:56561680-56561702 TGTTGGGAGTTGAGGCCTAATGG - Intronic
974147015 4:57961602-57961624 TGTTTGGGGTGGAGGCAAAAAGG + Intergenic
974299367 4:60043047-60043069 TGTTGGGGGTGGAGGAGGAGTGG + Intergenic
974760917 4:66272210-66272232 TGTTGGGGGTGGAGGGTGAGGGG + Intergenic
974769194 4:66388566-66388588 TGTTGGGGGTGGAGGATGAGGGG + Intergenic
974855423 4:67455130-67455152 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
974942975 4:68490589-68490611 TGATGTCAGTGGAGGCCAAAAGG - Intronic
975211332 4:71703623-71703645 TGGTGGGGGTGGAAACCAGATGG + Intergenic
975211370 4:71703981-71704003 TGGTGGGGGTGGAAACCAGATGG - Intergenic
975601568 4:76105568-76105590 TATTGGGGGTGGAGGCACCATGG + Intronic
975999105 4:80350778-80350800 TGTTGGGGGTGGAGGGAAAGGGG + Intronic
976142969 4:82012098-82012120 TGTTGGGGGTGGAGGTGGCAGGG + Intronic
976330499 4:83825830-83825852 TGTTGGGGGATGGGGGCAAAGGG - Intergenic
976549135 4:86374252-86374274 TGTTGGGGGTGGGGGACTAGGGG + Intronic
976981068 4:91229829-91229851 TGTCGGGGGTTGAGGGGAAAAGG + Intronic
977227129 4:94405981-94406003 TGATGGGGGAGGATGGCAAAGGG - Intergenic
978025020 4:103862771-103862793 TGTTGGAGGTGGGGGCCTAGTGG - Intergenic
978099100 4:104814943-104814965 TGTTGGGGGTGGAGAGCAATGGG + Intergenic
978150545 4:105428665-105428687 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
978664839 4:111170020-111170042 TGTTGGGGGTTGGGGGCAAGGGG + Intergenic
979035016 4:115705126-115705148 TGTTGGGGGTGGGTGGCAAGGGG - Intergenic
979087483 4:116430918-116430940 TGATGGGGATGGAGGCCAGGTGG - Intergenic
979245350 4:118497584-118497606 TGTTGGGAGGTGAGGCCTAATGG - Intergenic
980116077 4:128680111-128680133 TGGTGGCAGTGGAGGCTAAAAGG - Intergenic
980157066 4:129120610-129120632 TGTTGGGGGGTGAGGGGAAAGGG - Intergenic
980269146 4:130562106-130562128 TCTTGGAGGTGGAGCCTAAAGGG + Intergenic
980317097 4:131216557-131216579 TGTTGGGGTTGGGGGACAAGGGG - Intergenic
980364057 4:131776501-131776523 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
980364087 4:131776665-131776687 TGTAGGGGGTGGGGGCCTAGGGG - Intergenic
980380374 4:132006058-132006080 TCTTGGGGGTGGGGGGCAAGGGG + Intergenic
980904712 4:138937043-138937065 TGTTGGAGGTGGAGCCTAATGGG - Intergenic
981719124 4:147780919-147780941 AGTGGGAGGTGGAGGACAAATGG - Intronic
982732797 4:158974453-158974475 TGTTGCGGGTGGGGGGCAAGGGG - Intronic
982835401 4:160115556-160115578 TCATGGTGGGGGAGGCCAAATGG + Intergenic
982846089 4:160254158-160254180 TGATGAGGGAGAAGGCCAAATGG - Intergenic
982986023 4:162207370-162207392 TGTTGGGGTTATAGGCCAAGTGG - Intergenic
983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG + Exonic
983161089 4:164415590-164415612 TGTCGGGGGTTGAGGGCAAGGGG - Intergenic
983845646 4:172514581-172514603 ATCTGGGGGTGGAGGGCAAATGG - Intronic
983923223 4:173370126-173370148 GGTTGGGCGTGGAGGTGAAAAGG + Intronic
984558732 4:181243017-181243039 TGTTGGGGGCGGGGGACAAAGGG + Intergenic
985043381 4:185915696-185915718 TGCTGGGGGTGGGGGGCAGAAGG - Intronic
985685783 5:1280852-1280874 TTTTGGGGGAAAAGGCCAAAGGG - Intronic
986252425 5:6072509-6072531 TGTCGGGGGTGGGGGCCTAGAGG - Intergenic
986321834 5:6637722-6637744 TGTTAGGACTGGTGGCCAAATGG + Intronic
987223414 5:15814422-15814444 TGTTGGGGTTGGAGGACTAGGGG + Intronic
987258722 5:16182332-16182354 TGGTGGGGATGGAGGTGAAAAGG - Intergenic
987773058 5:22331031-22331053 TGTTGTTGGTGGTGGCCACAAGG + Intronic
988394000 5:30673795-30673817 TGTTGGGGGTGGGGGGCCAGGGG + Intergenic
988440508 5:31227653-31227675 AATTGGAGTTGGAGGCCAAAAGG - Intronic
989102434 5:37835206-37835228 TGGTTGGGGTGGAGGACGAAGGG - Intronic
989192962 5:38689248-38689270 TGTTGGTGGTTGAAGCCAAGGGG - Intergenic
989226383 5:39034326-39034348 TTTTGGGGGTGGAGCCAAGATGG + Intronic
989697695 5:44222816-44222838 TGTCGGGGGTGGGGGGCAAGGGG + Intergenic
989774198 5:45183145-45183167 TGTAGGGGGTGAGGGCCAATGGG - Intergenic
990062808 5:51672998-51673020 TGTCGGGGGTGGGGGGCAAGGGG - Intergenic
990064696 5:51698146-51698168 TGTTGGGGGTGGGGGGTAAGGGG - Intergenic
990276821 5:54205985-54206007 TTCTGGGGGTGGAGGAGAAAGGG - Intronic
991003286 5:61804253-61804275 TGTTGGCAGTGCATGCCAAATGG - Intergenic
991027166 5:62042398-62042420 AGTTGGGGGTGCAGGAGAAAAGG + Intergenic
992208190 5:74451662-74451684 TTTTGGGGGTTGGGGCCCAATGG + Intergenic
993198429 5:84781402-84781424 TGTTGGAGGTGAGGTCCAAAGGG - Intergenic
993207007 5:84894983-84895005 TGGTAGTGGTGGAGGCCACAGGG - Intergenic
993243903 5:85426898-85426920 AGTTGGGGGTGGGGGAAAAAGGG + Intergenic
993425695 5:87761774-87761796 TGTTGGGGGTTGCGGGCAATGGG - Intergenic
994665872 5:102704847-102704869 TGTTGGGAGGCGAGGCCTAATGG + Intergenic
994780501 5:104083651-104083673 TGTCGGGGGTGGGGGCCAAGGGG + Intergenic
994978119 5:106837858-106837880 TGTTGGGGGTGGGGGACTAGGGG - Intergenic
996192510 5:120563505-120563527 TGTTGGTGGTGGTGGCCACAGGG - Intronic
996974895 5:129420065-129420087 TGTAGGGGGTGGGGAACAAATGG + Intergenic
997808918 5:136947560-136947582 TGTGGGGGGTGGAGCCAAGATGG - Intergenic
997852595 5:137346164-137346186 TGCTGGGAGAGGAAGCCAAAGGG - Intronic
998570193 5:143250217-143250239 TGGTTGGGGTGGAGGCCAGCAGG - Intergenic
999387209 5:151162598-151162620 TGTTGGGGGTAAAGGCCTGATGG + Intergenic
999514858 5:152290882-152290904 TGGTGGGGGTGGGGGGCAAGAGG - Intergenic
999796223 5:154992144-154992166 TGCTGAGGGTGAAGGCCAATGGG + Intergenic
999827788 5:155290640-155290662 GGTTGGGGGTGGAGGGGAAATGG + Intergenic
1000493520 5:161947154-161947176 TGTTGGAGGTGGAGCCCAGTGGG - Intergenic
1001465051 5:171956955-171956977 TTTTGGGGGTGGATGGGAAAGGG - Intronic
1001891862 5:175345966-175345988 TGTCGGGGGTGGGGGGCTAAAGG + Intergenic
1002849955 6:985193-985215 TGTAGGGGGTTGAGGGCAAGGGG - Intergenic
1003778363 6:9394936-9394958 TGTAGGGGGTGGAGGTCAGCAGG + Intergenic
1004057477 6:12154635-12154657 TGTTGGGGGTGGGGGACAAGGGG + Intronic
1004231241 6:13835420-13835442 TGTTGGGGGTTGGGGGCAAGGGG + Intergenic
1004799008 6:19124730-19124752 TGTTGGGGGTGGTGGGCAAGGGG + Intergenic
1005544068 6:26845213-26845235 TGTTGGGGGTGGGGGCCTGGGGG + Intergenic
1005806792 6:29480997-29481019 TGTTGGGGGTGGGGGTCTAGGGG - Intergenic
1006017675 6:31095127-31095149 TTTTGGGGGTGGGGGACACATGG + Intergenic
1006920098 6:37622126-37622148 GGTTGGGGGAGGAGGGCAATTGG - Intergenic
1007933950 6:45716742-45716764 TGTTGGAGGTGGTGCCCAGAGGG - Intergenic
1008401504 6:51068788-51068810 TGTTGGAGGTGGGGCCCAATGGG - Intergenic
1009714513 6:67372256-67372278 TTTTGGGGGAGGAGGACATATGG + Intergenic
1009717725 6:67422590-67422612 TGTTGGGGTTGGAGGGCAAGGGG - Intergenic
1010434892 6:75817564-75817586 TGTAGGGTGTGGCGCCCAAACGG - Exonic
1010852841 6:80799427-80799449 TGTTGGGGGTTGGGGCACAATGG - Intergenic
1011004232 6:82625473-82625495 TGTTGGGGGATGGGGCCTAATGG + Intergenic
1011303667 6:85903177-85903199 TGTTGGGGGTGGCGGGCTAGGGG - Intergenic
1012391910 6:98751219-98751241 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1013601714 6:111711591-111711613 TGGTGGCGCTGGAGGCCACAGGG - Intronic
1013729918 6:113153506-113153528 TGTTGGGAGATGAGGCCTAAGGG + Intergenic
1014322338 6:119945723-119945745 TGTTGGGGGTGGGGGCTGAATGG - Intergenic
1015162618 6:130170193-130170215 TGTTGGCGGTGGGGGACAAGGGG - Intronic
1015206980 6:130651158-130651180 TGTTGGAGGTGGGGCCCAATGGG - Intergenic
1015292172 6:131549705-131549727 TGTTGGGGGAGGAGGAGAAAGGG - Intergenic
1017138352 6:151167847-151167869 TGGTGGAGATGGAAGCCAAAGGG + Intergenic
1017639539 6:156477827-156477849 TGTTGGGGGTGGGAGGCAAGGGG + Intergenic
1018501747 6:164418850-164418872 TGTTGGGGGTGGAGGGTAAGGGG - Intergenic
1018967040 6:168497310-168497332 TGTCAGGGCTGGAGGCTAAACGG - Intronic
1019130332 6:169868590-169868612 TGGCGGGGGTGGAGGCCGTAGGG - Intergenic
1019151905 6:170011945-170011967 TGTGGAGTGTGGAGGCCCAACGG + Intergenic
1019484051 7:1280267-1280289 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
1019692680 7:2425423-2425445 TTTTGGGGGTGGAGGGTAAAAGG - Intronic
1020759879 7:12255126-12255148 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
1020975350 7:14999485-14999507 TGTTGGAGGTGGGGCCTAAAGGG + Intergenic
1021018973 7:15572759-15572781 TCATGAGGGTGGAGGCCACATGG - Intergenic
1021535589 7:21700954-21700976 TGTTGGGGGTGGAGGGCTAGGGG + Intronic
1021606684 7:22415350-22415372 TGTTGGGAGGTGAGGCCTAACGG + Intergenic
1022435984 7:30385542-30385564 TGTTGTAGGTGGGGGCCTAATGG - Intronic
1022441545 7:30437219-30437241 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1022501174 7:30883230-30883252 GGTTGGGGGTGGGGGCTAAATGG + Intronic
1022517880 7:30987337-30987359 TGCTGGGGGTGGGCGCCAACAGG + Intronic
1022688846 7:32625087-32625109 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
1022933839 7:35151813-35151835 GGTTGGGGGTGGAGCCAAGATGG + Intergenic
1023521875 7:41057591-41057613 TGTTGGGGGAGGAAGCCAGTGGG + Intergenic
1023585875 7:41729280-41729302 TACTGGGGGTGGAGGGGAAATGG - Intergenic
1024316584 7:48024887-48024909 TGTTGCAGGTGGGGGCCTAATGG - Intronic
1024448264 7:49508032-49508054 TGTTGGGAGGTGAGGCCTAATGG - Intergenic
1026004552 7:66590877-66590899 TGTTGGGTGTGGAGCCTAGAAGG - Intergenic
1026078026 7:67191204-67191226 TGTTGGGGGTGGAGCCCAGTGGG - Intronic
1026639644 7:72113137-72113159 TGTTGGAGGTGGAGCCTAATGGG + Intronic
1026698852 7:72621089-72621111 TGTTGGGGGTGGAGCCCAATGGG + Intronic
1027147048 7:75702935-75702957 TGTTGGAGATGGGGGCCTAATGG - Intronic
1027232422 7:76280560-76280582 GGTGGGGGGCGGGGGCCAAAGGG - Intronic
1027864031 7:83623870-83623892 TGTTGGGGGTGGGGGGCAAGGGG - Intronic
1027874923 7:83756664-83756686 TGTTGGGGGAGGGGGGCAAGAGG - Intergenic
1027928367 7:84497419-84497441 TTTTGGGGGTGGGGGACAGAGGG + Intergenic
1027965050 7:84993573-84993595 AGTTGGGGGTGGAGCCAAGATGG - Intergenic
1028235589 7:88357520-88357542 TGTTGGGGGTGGAAGGCTGATGG + Intergenic
1028830374 7:95321240-95321262 TGTTGGAGGTGGGGCCCAATGGG - Intronic
1028888041 7:95956528-95956550 TGTCGGGGGTGGGGGGCAAGAGG - Intronic
1028985085 7:97003233-97003255 TGTGGGGGGTGGGGGACAGAAGG - Intergenic
1029850227 7:103453959-103453981 TGGTGGGGGTGGAGCCAAGACGG - Intergenic
1029877036 7:103765022-103765044 TGCTGGCGGTAGAGGCCAGATGG + Intronic
1030973497 7:116090961-116090983 TGTCGGGGGTGGGGGGCAAGGGG + Intronic
1030998932 7:116392218-116392240 TGTCGGGGGTGGCGGGCAAGGGG + Intronic
1031591728 7:123601065-123601087 TGTAGGGGATAGAGGCCAGATGG + Intronic
1032845158 7:135745770-135745792 TGGTGGGGCTGGGGGCCAAAGGG + Intronic
1032890129 7:136185577-136185599 TGTTGGGGGTTGGGGGCAAGGGG - Intergenic
1032958956 7:137007461-137007483 TGGTGGGGGTGGTGGCCGCAAGG - Intronic
1033083499 7:138320707-138320729 TGTCGGGGGTGGGGGCCAAGGGG + Intergenic
1033116878 7:138633299-138633321 TGTCGGGGGTGGAGGCTTATGGG + Intronic
1033305786 7:140224326-140224348 CGTTGGAGGAGGAGGCCAGAGGG + Intergenic
1033381970 7:140830384-140830406 AACTGGGGTTGGAGGCCAAAGGG - Intronic
1033963938 7:146950440-146950462 TGTTGGTGGTGGGGGGCAAGGGG - Intronic
1034071585 7:148191124-148191146 TGTTGGGAGGTGAGGCCTAATGG + Intronic
1034285700 7:149881866-149881888 TCTTGGGGGTAGAGGACAATGGG - Intergenic
1034470592 7:151252345-151252367 TGCTGGGGGTGTAGGGAAAAGGG - Intronic
1034704930 7:153132924-153132946 TGTTGGAGTTGGGGGCCTAATGG - Intergenic
1034750857 7:153567785-153567807 TGTTGGAGGTGGAGCCGAATGGG - Intergenic
1034791845 7:153977702-153977724 TGTCGGGGGTGGGGGACAAGGGG - Intronic
1035782812 8:2242271-2242293 TGTTGGAGGTGGGGGACAAGGGG + Intergenic
1035809318 8:2477314-2477336 TGTTGGAGGTGGGGGACAAGGGG - Intergenic
1035827810 8:2663305-2663327 TGTTGGCGGTGGGGGACAAGGGG - Intergenic
1035938145 8:3865519-3865541 AGTTGGGGGTGGAGGCAATGAGG + Intronic
1036434898 8:8723861-8723883 TGTTGGGGGTGAAGGGGAATGGG + Intergenic
1037009803 8:13827228-13827250 TGTTGGGGGTAGGGGGCAGAGGG - Intergenic
1037526127 8:19725800-19725822 TGTTGGGGGTAGAGGGTATATGG - Intronic
1037911006 8:22743532-22743554 TGTTTGGAGTGGGGGCTAAATGG + Intronic
1039043384 8:33428661-33428683 TGTTGGGGGGTGTGGCCTAATGG + Intronic
1040914931 8:52559140-52559162 TGTTGGAGGTGGAGGCTAATGGG - Intronic
1041286408 8:56266438-56266460 TTTTGGGGGTGGAGCCAAGATGG - Intergenic
1041392808 8:57361934-57361956 TGTTGGAGGAGGAGGAGAAATGG - Intergenic
1041645501 8:60247401-60247423 TGTTGGGGGTGGAGCGGAAGGGG - Intronic
1041813852 8:61943976-61943998 TGTTGGGAGGCGAGGTCAAATGG + Intergenic
1044759989 8:95507685-95507707 TGTTGGGGGTGGGGGTCCAGGGG - Intergenic
1045368364 8:101496569-101496591 TGTTGGGGGTGGGGGAAAAGGGG + Intronic
1045994963 8:108351936-108351958 TGTTGGTGGTGGTGGCCAGAGGG + Intronic
1046878040 8:119277718-119277740 TGCAGGGGGTGGAGGCCTCATGG - Intergenic
1047736905 8:127773742-127773764 TGTCGGGGGTGGGGGACAAGGGG + Intergenic
1048448962 8:134514954-134514976 TGTTGGGGGTGGAGGGCTAGGGG - Intronic
1048980477 8:139701224-139701246 TGTTTGGGGTGCTGGGCAAAGGG + Intronic
1049122096 8:140747972-140747994 TGCTGGGGGAGGAGGTGAAATGG + Intronic
1049341461 8:142114817-142114839 TGTTGGGGCTGGAGGCGGGAGGG - Intergenic
1050032304 9:1399337-1399359 TGTTGGGGGTAGGGGGCAAGGGG + Intergenic
1050121878 9:2316633-2316655 TGCTAGAGGTGGTGGCCAAAGGG - Intergenic
1050403544 9:5282624-5282646 TGTTGGGGGTTGGGGGCAAGGGG + Intergenic
1050821259 9:9882811-9882833 TGTTGGAAGTGGGGGCCTAATGG + Intronic
1050972799 9:11897880-11897902 TGTCAGGGGTGGGGGCCAAGGGG + Intergenic
1051360164 9:16275297-16275319 GTTTGGGGGCAGAGGCCAAAGGG - Intronic
1052556149 9:30020725-30020747 TGTTGGGGGTTGGGGGCAAGGGG - Intergenic
1052596927 9:30573298-30573320 TGTCGGGGGTGGAGGACAAGTGG + Intergenic
1053033320 9:34801904-34801926 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
1053628407 9:39902386-39902408 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
1053777652 9:41563941-41563963 TGTTGGGGGTGGAGGGCAAGGGG + Intergenic
1054215480 9:62348315-62348337 TGTTGGGGGTGGAGGGCAAGGGG + Intergenic
1054672001 9:67807032-67807054 TGTTGGGGGTGGAGGGCAAGGGG - Intergenic
1054871040 9:70047348-70047370 TGTTGGGGGTGGGGCGCAAGGGG - Intronic
1055276113 9:74618773-74618795 TGTGGGGGGTGGAAGGCCAAAGG + Intronic
1055398841 9:75901466-75901488 TGTTGGGGGTGGCGGGAAAAGGG + Intronic
1055595940 9:77864291-77864313 TGTTGGAGGTGGAGCCTAATGGG - Intronic
1056255455 9:84794997-84795019 TTTGGGGGGTGGAGGGCACAGGG - Intronic
1057676173 9:97137663-97137685 GGTTGGGGGTGGAAGGAAAAAGG - Intergenic
1057940037 9:99273800-99273822 TGTTGGGGGTGGAGGACTGGGGG + Intergenic
1058161135 9:101571803-101571825 GGTTGGGGGTGGAGGTCTAGAGG - Exonic
1058226081 9:102365652-102365674 TGTTGGGGGTAGAGAGCAAGGGG - Intergenic
1058341610 9:103904404-103904426 TGTTGGAGGTGGGGCCCAATGGG + Intergenic
1058873559 9:109222949-109222971 TTCTGGAGTTGGAGGCCAAATGG - Intronic
1058934939 9:109761520-109761542 TGTTGGGGGTGGGGGACAAGGGG - Intronic
1059261744 9:112983688-112983710 TGTTGGGAGGTGAGGCCTAATGG - Intergenic
1059729130 9:117039424-117039446 TGTTGGGGGTTGGGGAGAAAGGG + Intronic
1060208482 9:121696561-121696583 TCATGGGGGTGGAGGGCCAAGGG - Intronic
1060389473 9:123267123-123267145 TGTGTGAGGTGGAGGGCAAAAGG - Intronic
1060661053 9:125405490-125405512 TGTTGGGGGTGGGGAGGAAAAGG + Intergenic
1061150331 9:128824518-128824540 GGTTGGGAATGGAGGCAAAAGGG - Intronic
1062317939 9:135977677-135977699 TGCTGGGGGTGGAGGTCTAGGGG - Intergenic
1062317997 9:135977821-135977843 TGCTGGGGGTGGAGGTCTAGGGG - Intergenic
1062318011 9:135977857-135977879 TGCTGGGGGTGGAGGTCTAGGGG - Intergenic
1062318025 9:135977893-135977915 TGCTGGGGGTGGAGGTCTAGGGG - Intergenic
1062318038 9:135977929-135977951 TGCTGGGGGTGGAGGTCTAGGGG - Intergenic
1062318051 9:135977965-135977987 TGCTGGGGGTGGAGGTCTAGGGG - Intergenic
1062327055 9:136017504-136017526 TGGTGGGGGTGGGGGGCAACAGG - Intronic
1185957366 X:4506122-4506144 TGTTGGAGGTGGAGCCTAACGGG - Intergenic
1186333189 X:8558167-8558189 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1186618940 X:11216861-11216883 TGTCGGGGGTGGAGGGCTAGGGG - Intronic
1186631707 X:11356258-11356280 TGTTGGGGGTGGGGGACAAGGGG + Intronic
1186719092 X:12283226-12283248 TGTTTAGGGTGAAGGCCAAGTGG + Intronic
1187110554 X:16294780-16294802 TGTTGGGAGATGAGGCCTAATGG + Intergenic
1187804560 X:23104622-23104644 TGTCGGGGGTGGGGGGCAAAGGG + Intergenic
1188033072 X:25285775-25285797 TGTTGGGAGGTGGGGCCAAAAGG - Intergenic
1188263379 X:28042186-28042208 GGTTGGGGGTGGGGGCGTAAGGG + Intergenic
1188803363 X:34558626-34558648 TGTTGGAGGTGGAGCCTAATGGG + Intergenic
1189315117 X:40049780-40049802 TATTGGGGTTGGAGGCAAAGGGG - Intergenic
1189858773 X:45251097-45251119 TGTTGGAGGTGGAGCCTAATGGG - Intergenic
1190032288 X:46985877-46985899 TGTTGGAGGTGCAGGCCTAATGG + Intronic
1191104062 X:56761382-56761404 TGTTGGGGGTGGAGACAGCAGGG + Intergenic
1191173428 X:57474354-57474376 TGTTGGGGGCGGGGGACAAGGGG - Intronic
1191806326 X:65138236-65138258 GGTTAGGGGTGGAGGGGAAAGGG - Intergenic
1191854557 X:65613026-65613048 TGTTGGGGGTTGGGGGCAAGGGG - Intronic
1192137424 X:68616780-68616802 TGTTGGGGGTGGGGCCTAATGGG - Intergenic
1192540339 X:71964209-71964231 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1192599760 X:72449423-72449445 TGTTGGGGTTGGGGGCCTAGGGG + Intronic
1192637553 X:72833632-72833654 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1192644161 X:72887182-72887204 TGTTGGGGGTGGGGGGCAAGGGG - Intronic
1192963700 X:76155448-76155470 TGTCGGGGGTGGGGGACAAGGGG + Intergenic
1193056288 X:77154713-77154735 TTTTGGGGGTGGGGGACAAGGGG + Intergenic
1193160706 X:78226048-78226070 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1193552952 X:82921573-82921595 TGTTGGGGGTGTGGGGCAAGGGG - Intergenic
1193568883 X:83116893-83116915 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1193917166 X:87379433-87379455 TGATGGTGGTGGTGGCCAGAAGG + Intergenic
1193945636 X:87729655-87729677 TGTTGGAGGTGGGGGCCTAATGG - Intergenic
1194190715 X:90834032-90834054 TGTCGGGGGTGGGGGTCAAGGGG - Intergenic
1194841925 X:98753776-98753798 TGGTGGTGGTGGTGGCCACAGGG - Intergenic
1194980085 X:100431637-100431659 TGTTGGGAGGGGAGGGCAAAAGG - Intergenic
1195143660 X:101990247-101990269 GATTGGGGTTGGAGGACAAATGG - Intergenic
1195300968 X:103529628-103529650 TGTTGGAGGTGGAGCCTAACAGG + Intergenic
1195762854 X:108265594-108265616 TGTTGGGTGAGGAAGCCAAGTGG + Intronic
1196288015 X:113905266-113905288 TGTTGGAGGTGGAGCCTAACAGG + Intergenic
1196380772 X:115086593-115086615 TATTGGGGGTGGAGCCAAGAAGG - Intergenic
1196602335 X:117616850-117616872 TTTAGGGGGTGGAGGGCAAGTGG - Intergenic
1196724437 X:118883659-118883681 TGTTGGAGGTGGAGCCCACTGGG + Intergenic
1196823544 X:119722942-119722964 TGGTGGGTGTGTAGGCCAATTGG + Intergenic
1197434845 X:126414093-126414115 TGTAGGGGGTGGGGGGCAAGGGG + Intergenic
1197689771 X:129485650-129485672 TGTTGGAGGTGGGGCCCAATAGG + Intronic
1198172078 X:134117176-134117198 TGCTGGAGGTGGAGCCCAGATGG + Intergenic
1198982052 X:142409051-142409073 TGATAGTGGTGGAGGCCACAGGG + Intergenic
1199021602 X:142884714-142884736 TGTCGGGGGTGGGGGGCAAGGGG + Intergenic
1199052039 X:143247029-143247051 GGTTGAGGGTGGAGGAAAAATGG + Intergenic
1199284060 X:146036842-146036864 TGTAGAGGGTGGAGTCAAAAGGG - Intergenic
1199376922 X:147123764-147123786 TGTTGGAGGTGGAGTCTAATGGG + Intergenic
1199402375 X:147413326-147413348 TGTCAGGGGTGGAGGGCAAGGGG + Intergenic
1199741602 X:150740986-150741008 TGTTGGAGGTGGAGCCTAATGGG - Intronic
1199788291 X:151125768-151125790 TGTTGGGGGTGGGGTGCAAGGGG + Intergenic
1200163038 X:154018996-154019018 AGATGGCGGTGGAGGCCACAGGG + Exonic
1200409757 Y:2849561-2849583 TCTTGGGGCTGGAGGACAGAAGG + Intronic
1200784144 Y:7244361-7244383 TGTTGGGGGAGGAAGCCAGTGGG + Intergenic
1201021469 Y:9662239-9662261 TGTTGGGGGTGGGGGGCTAGTGG + Intergenic
1201595428 Y:15662942-15662964 TGTTGGGGGTTGGGGGCATAGGG - Intergenic
1201745716 Y:17371046-17371068 TGTTGGAGGTGGAGCCTAACTGG - Intergenic
1201933565 Y:19380957-19380979 TGTTGGGGTTGGAGGGAAGATGG - Intergenic
1201939209 Y:19440905-19440927 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic