ID: 1147418637

View in Genome Browser
Species Human (GRCh38)
Location 17:40311099-40311121
Sequence ACAAGGACGCCAAGCAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 181}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147418637_1147418648 20 Left 1147418637 17:40311099-40311121 CCATCCCTGCTTGGCGTCCTTGT 0: 1
1: 0
2: 0
3: 15
4: 181
Right 1147418648 17:40311142-40311164 GGCCTCCTTGTCTGGCTCACTGG 0: 1
1: 0
2: 2
3: 15
4: 208
1147418637_1147418649 21 Left 1147418637 17:40311099-40311121 CCATCCCTGCTTGGCGTCCTTGT 0: 1
1: 0
2: 0
3: 15
4: 181
Right 1147418649 17:40311143-40311165 GCCTCCTTGTCTGGCTCACTGGG 0: 1
1: 0
2: 0
3: 20
4: 190
1147418637_1147418652 25 Left 1147418637 17:40311099-40311121 CCATCCCTGCTTGGCGTCCTTGT 0: 1
1: 0
2: 0
3: 15
4: 181
Right 1147418652 17:40311147-40311169 CCTTGTCTGGCTCACTGGGCAGG 0: 1
1: 0
2: 5
3: 12
4: 184
1147418637_1147418641 -1 Left 1147418637 17:40311099-40311121 CCATCCCTGCTTGGCGTCCTTGT 0: 1
1: 0
2: 0
3: 15
4: 181
Right 1147418641 17:40311121-40311143 TCTCTCTCTCCCCTGCCCAGTGG 0: 1
1: 2
2: 5
3: 84
4: 633
1147418637_1147418645 12 Left 1147418637 17:40311099-40311121 CCATCCCTGCTTGGCGTCCTTGT 0: 1
1: 0
2: 0
3: 15
4: 181
Right 1147418645 17:40311134-40311156 TGCCCAGTGGCCTCCTTGTCTGG 0: 1
1: 0
2: 1
3: 20
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147418637 Original CRISPR ACAAGGACGCCAAGCAGGGA TGG (reversed) Intronic
900467921 1:2834865-2834887 ATAAGGACACCAGGCATGGAGGG + Intergenic
901296091 1:8161875-8161897 ACAGGGACGTCAAGCAGGAGGGG - Intergenic
901795342 1:11676436-11676458 ACCAGGACACCAAGCCAGGAGGG + Intronic
901961180 1:12827912-12827934 AGAGGGACAACAAGCAGGGAGGG - Intronic
901985840 1:13074555-13074577 ACAGGGACAAGAAGCAGGGAGGG + Intronic
901995969 1:13152212-13152234 ACAGGGACAAGAAGCAGGGAGGG - Intergenic
902017400 1:13319268-13319290 AGAGGGACAACAAGCAGGGAGGG + Intronic
902212442 1:14913663-14913685 ACAAAGACGCCCAGCAAGGTTGG - Intronic
904271284 1:29351781-29351803 AGAAATAGGCCAAGCAGGGAGGG - Intergenic
905015428 1:34775049-34775071 ACAAGGAAGCCAATGAGGCAGGG + Intronic
905542003 1:38767256-38767278 ACAAGGAGGGGCAGCAGGGATGG + Intergenic
907158680 1:52356145-52356167 ACAGGGGCTCCAGGCAGGGAGGG - Intronic
907328991 1:53659169-53659191 GCAAGGAGGCCAGGAAGGGAAGG + Intronic
907796956 1:57727490-57727512 ACAGGTAGGCCAGGCAGGGATGG + Intronic
908251921 1:62272621-62272643 ACAAAGATGCCAGCCAGGGAGGG - Intronic
909391866 1:75129279-75129301 GGAAGGAAGGCAAGCAGGGAAGG + Intronic
913326439 1:117632377-117632399 ACAATGAAACCAAGAAGGGAGGG + Intergenic
916218843 1:162422786-162422808 ACAAGGCTGCCCAGCAGGGATGG - Intergenic
918039138 1:180901596-180901618 ACAAGGGCTACAAGCTGGGAAGG + Intergenic
918406090 1:184213201-184213223 CCAAGGAGGCCAACTAGGGAAGG - Intergenic
921161405 1:212474818-212474840 ACCAGGACTCCAAGCAGAAAGGG + Intergenic
921699215 1:218248188-218248210 AAAAGGACAGCAAGCAGGTAAGG + Intergenic
922209166 1:223474385-223474407 AGAAGGAAGGGAAGCAGGGAGGG + Intergenic
1067275908 10:44834008-44834030 ACAAGAAAACCAAGCAGTGATGG - Intergenic
1067914673 10:50384484-50384506 GAAAGGAAGGCAAGCAGGGATGG - Intronic
1072630255 10:97140575-97140597 TCGCGGAGGCCAAGCAGGGAAGG - Intronic
1073213968 10:101826493-101826515 ACAGGGACGATAAGCAAGGAGGG + Intronic
1074453882 10:113580854-113580876 ACCAGGATGCCAAGCAGGTCTGG + Intronic
1075855576 10:125626671-125626693 AGAAGGAGGGCAATCAGGGAGGG + Intronic
1077027739 11:448695-448717 ACAGCCACGCCCAGCAGGGATGG - Intronic
1077897574 11:6465174-6465196 ACAACAAGGACAAGCAGGGAAGG + Intronic
1081995141 11:47359229-47359251 ACCAGGAGGCCCAGCTGGGAGGG - Intronic
1083332174 11:61904026-61904048 AGAAGTTTGCCAAGCAGGGAAGG - Intronic
1083720008 11:64599382-64599404 ACAAAGCCCCCAAGCAGAGAGGG + Intronic
1085717743 11:78888156-78888178 ACAATGACCCATAGCAGGGATGG + Intronic
1085774616 11:79354189-79354211 ACAAGGATGCCATTCAGTGAGGG - Intronic
1085830376 11:79894251-79894273 ACAAGGATTCCAAACAGAGATGG - Intergenic
1088375131 11:109132523-109132545 ACAAGGAAGGAAAGAAGGGAGGG + Intergenic
1088540448 11:110908295-110908317 ACAAGGAAGCAAAACAGGGAAGG + Intergenic
1088924340 11:114285131-114285153 AGAAGGATGCCAAGGAGGGAGGG - Intronic
1089372196 11:117969348-117969370 ACAACCAGGCCCAGCAGGGAAGG - Intergenic
1090656863 11:128852821-128852843 ACAAGGAAGACAAGCAGGAAGGG + Intronic
1092140357 12:6179366-6179388 AAAAGGAGGCCATGGAGGGAAGG + Intergenic
1093749933 12:22786541-22786563 ACAAAGGAGCCAAGCAAGGAGGG - Intergenic
1094147646 12:27246999-27247021 ATGAGGAAGCCAAGGAGGGAGGG + Intronic
1095090524 12:38099875-38099897 AGCAGGACGCCACGCAGGGACGG - Intergenic
1096081577 12:48836749-48836771 AGAAGGAAGCCAAGCAGCGCTGG - Exonic
1099617207 12:84951286-84951308 ACAAGGAAGACAGGAAGGGAGGG - Intergenic
1100289895 12:93203757-93203779 ATGAGGAAGCCAAGCATGGAAGG + Intergenic
1100362713 12:93893015-93893037 ACAAGGTCCCCAAGACGGGAAGG + Intronic
1102952061 12:117037714-117037736 AGAACGACGCCACCCAGGGAGGG + Intergenic
1104855536 12:131900779-131900801 CCCAGGACCCCAAGCAGGGCTGG - Intronic
1104953190 12:132451514-132451536 GGGAGGACGCCAAGCAGGGGCGG + Intergenic
1106591218 13:31100423-31100445 ATAAGGAAGGCAGGCAGGGAGGG - Intergenic
1107911920 13:45113326-45113348 ACAAGGACACCACACAGGGATGG + Intergenic
1108020918 13:46127030-46127052 ACAAGGACGGCCAGAAGAGATGG + Exonic
1109828466 13:67754824-67754846 AGGAAGACTCCAAGCAGGGAGGG + Intergenic
1113235303 13:108266662-108266684 AGAGGGACAGCAAGCAGGGATGG - Intronic
1117735087 14:58761089-58761111 ATAAGGACCCCAAGCAAGTATGG + Intergenic
1119247781 14:73127789-73127811 AGAAAGACTCCAAGCTGGGAGGG - Intergenic
1120064297 14:80022057-80022079 ACATGGACACAAAGAAGGGAAGG - Intergenic
1120913493 14:89689296-89689318 AAAATGACACCAAGTAGGGAGGG - Intergenic
1124407494 15:29405031-29405053 ACCAGGAGTCCAGGCAGGGAGGG - Intronic
1127781070 15:62316585-62316607 ACAAGGGAACAAAGCAGGGAAGG + Intergenic
1128385583 15:67145934-67145956 ACAAGGTCACCCAGCAGGCAGGG - Intronic
1130882895 15:88070357-88070379 AGAAGGAAGGCAAGCAGGGGCGG + Intronic
1131433217 15:92402986-92403008 ACAAGGAAGGGAAGGAGGGAGGG + Intronic
1132518265 16:375965-375987 ACAAGGCTGCCCAGCAGGGGAGG + Intronic
1132580471 16:682495-682517 ACCAGGACGCCAGGTAGGGCAGG - Exonic
1133480508 16:6166233-6166255 ACCAGGACAGCAGGCAGGGAAGG - Intronic
1134522191 16:14923911-14923933 GGAGGGACGCCAAGCAGGGCAGG + Intronic
1134709861 16:16322562-16322584 GGAGGGACGCCAAGCAGGGCAGG + Intergenic
1134949742 16:18346083-18346105 GGAGGGACGCCAAGCAGGGCAGG - Intergenic
1140193839 16:72840376-72840398 ACAAGAACGACAGCCAGGGAAGG + Intronic
1142555174 17:770332-770354 AAAAGGACCTCAAGAAGGGAAGG + Intronic
1144802670 17:17941378-17941400 ACAAGGAAGCCAAGCATATAAGG - Intronic
1147418637 17:40311099-40311121 ACAAGGACGCCAAGCAGGGATGG - Intronic
1150743990 17:67801597-67801619 AAAAAGACTCCAAGCAGGGCGGG + Intergenic
1150803652 17:68301825-68301847 ATCAGGAAGCCAAGCAGGAAAGG - Intronic
1151100457 17:71550500-71550522 TCAAGGACACAAATCAGGGAGGG + Intergenic
1152098435 17:78286700-78286722 AGAAGGAGGCCAAGCAGAGAGGG + Intergenic
1153254788 18:3159953-3159975 AGAAGGAAGGCAGGCAGGGAAGG - Intronic
1155505113 18:26525711-26525733 GGAAGGAAGCCAGGCAGGGAGGG - Intronic
1155518315 18:26644436-26644458 ACAAGGAAGACAAGCAGTGGGGG + Intronic
1155642334 18:28033147-28033169 GCATGGACGCCAGGCAGTGATGG + Intronic
1156312680 18:35939287-35939309 ACAGGAACCACAAGCAGGGAAGG + Intergenic
1160134711 18:76262414-76262436 ACCAGGACAGCCAGCAGGGAAGG + Intergenic
1160938681 19:1609930-1609952 ACAAGGCCTCAATGCAGGGAGGG + Exonic
1161307298 19:3575191-3575213 ACAGGGATGCAAAGCAGTGATGG - Intronic
1161590613 19:5127654-5127676 ACCAGGCAGCCAACCAGGGAGGG + Intronic
1162087480 19:8257279-8257301 CCAAGGAAGCCAAGAAGGGTGGG - Intronic
1162964093 19:14147895-14147917 AAAAGGAGACCAAGGAGGGAGGG + Exonic
1163398845 19:17079639-17079661 AGGAGGGGGCCAAGCAGGGAAGG - Intronic
1163837079 19:19581620-19581642 ACCAGGACACCAAACAAGGAAGG + Intronic
1167253936 19:48415923-48415945 ACACGGACGGCGAGCAGAGACGG - Intronic
924966355 2:80139-80161 AGAAAGACTCCAAGCTGGGAGGG + Intergenic
926358051 2:12059361-12059383 ACCAGGAGGTCAGGCAGGGAGGG + Intergenic
927845516 2:26470386-26470408 AAAAGAAAACCAAGCAGGGAAGG + Intronic
933360543 2:81277253-81277275 ATAAGGAGGCCAAGCATGGTGGG - Intergenic
934728665 2:96642252-96642274 AAAAGGACGGCAAGGAGGGCAGG + Intronic
934849617 2:97689607-97689629 ACAAGTGCCCCAGGCAGGGAGGG + Intergenic
935730995 2:106065215-106065237 GCAAGGCCCCCAAGCAGGGAGGG + Intronic
937078556 2:119124595-119124617 AGAAGGGAGCCAAGCTGGGAAGG + Intergenic
940330586 2:152470056-152470078 ACACAGACACAAAGCAGGGAGGG - Intronic
941626201 2:167833250-167833272 ACAAAGAAGCCAAGGAGGGAAGG - Intergenic
947101006 2:226621213-226621235 GCAAGGAAGCCCAGCAGGGAAGG + Intergenic
947561857 2:231161393-231161415 ACAAGGACGCCAACCACAGAAGG - Exonic
1169195711 20:3681139-3681161 ACAGGGAGGGCAACCAGGGAGGG - Intronic
1172779547 20:37427763-37427785 ACAAGGACCCCAGACAGAGAAGG - Intergenic
1175942011 20:62541803-62541825 ACAAGGACCACAGGCAGGGAAGG - Intergenic
1177811638 21:25931048-25931070 AAAAGGAAGGCAGGCAGGGAGGG - Intronic
1178251054 21:31003732-31003754 AAGAGGAAGCCAAGCAGGGCCGG - Intergenic
1178384655 21:32139318-32139340 CAAAGGTCGCCAAGCAGGCAGGG + Intergenic
1178406646 21:32329611-32329633 CCAAGGACTCAAAGAAGGGAAGG + Intronic
1179111380 21:38448798-38448820 ACAGGGCTGCCAGGCAGGGAGGG - Intronic
1179456062 21:41501117-41501139 ACAAGGAAGCCAGGGAAGGAAGG + Intronic
1179681138 21:43022098-43022120 ACAGGGAGGCCAAGGCGGGAAGG + Intronic
1180702120 22:17787013-17787035 CCAGGGGCGCCATGCAGGGAGGG - Intergenic
1180784814 22:18541004-18541026 ACAGGGACTCCAAGAATGGAGGG - Intergenic
1181128397 22:20715057-20715079 AAAAGGACTCCAAGAATGGAGGG - Intronic
1181241719 22:21480359-21480381 ACAGGGACTCCAAGAATGGAGGG - Intergenic
1183359849 22:37377762-37377784 ACAAGGCAGCCAGGCAGGAAGGG + Intronic
1184649631 22:45913600-45913622 ACAGGGACCCCAGGGAGGGAAGG - Intergenic
1185368099 22:50446169-50446191 ACAGTGACACCAAGAAGGGAAGG + Exonic
1203295145 22_KI270736v1_random:35011-35033 AGAAGCACTCCAAGCATGGAGGG - Intergenic
950668972 3:14513866-14513888 ACAAGAACGCCATGCAGGGCAGG + Intronic
953903418 3:46856348-46856370 AGAAGGACTGAAAGCAGGGAGGG - Intergenic
954072403 3:48152364-48152386 GCCAGGAAGCCAGGCAGGGAGGG - Intergenic
954852311 3:53614047-53614069 ACTAGGAGGCCAAGGTGGGAGGG + Intronic
955086971 3:55712274-55712296 AAAAGCAGGCCATGCAGGGAAGG + Intronic
955940301 3:64140716-64140738 ACAAGGCAGACAAGCAGAGATGG - Intronic
956773583 3:72547285-72547307 TGAAGGATGGCAAGCAGGGAGGG - Intergenic
960926043 3:122795495-122795517 ACATGAACGCGAAGCAGGGCAGG - Exonic
961655475 3:128439263-128439285 ACAGGGGAGCCAGGCAGGGAAGG + Intergenic
968643221 4:1725503-1725525 ACAACGACCCCAAGAAGGAAGGG + Intronic
969193038 4:5538086-5538108 AGAAGGAAGGGAAGCAGGGAGGG + Intergenic
969221370 4:5761075-5761097 CCAAGGACGCCCAGCCAGGAGGG - Intronic
969716699 4:8871432-8871454 ACGAGGACGCCGAGCAGGCGCGG - Exonic
971367840 4:25991891-25991913 AGAGGGAGGCCAAGCAGGAAAGG - Intergenic
973741599 4:53924449-53924471 GCAAGGCCTCCAGGCAGGGAGGG - Intronic
973943342 4:55932554-55932576 ACAAGGAGGAAAAGTAGGGAAGG + Intergenic
985226852 4:187770591-187770613 AGGAAGACTCCAAGCAGGGAGGG + Intergenic
987256975 5:16165077-16165099 CCAAAGACTCTAAGCAGGGAAGG - Intronic
990950599 5:61294565-61294587 AACAGGGAGCCAAGCAGGGAAGG + Intergenic
994762272 5:103869842-103869864 ACAACAACGTAAAGCAGGGATGG + Intergenic
996402567 5:123078671-123078693 ACAAGGAGGTCAAGGCGGGAGGG + Intergenic
998577400 5:143331741-143331763 ACAGGGACACAAAGAAGGGAAGG + Intronic
998639603 5:143994884-143994906 ACAGGGACACGAAGCTGGGATGG + Intergenic
999144531 5:149383559-149383581 AGAAGGACTCCTACCAGGGAGGG - Intronic
1001269817 5:170302753-170302775 ACAAGGATCCCAGGCATGGAGGG - Intergenic
1001561816 5:172674701-172674723 CCAAGGTTCCCAAGCAGGGAGGG - Intronic
1003521198 6:6860135-6860157 AGAAGGAAGGCAAGGAGGGAGGG + Intergenic
1004333814 6:14745638-14745660 ACAAACAAGACAAGCAGGGAGGG + Intergenic
1005992274 6:30910736-30910758 ACAAGTACGCCGAGGAGCGATGG + Exonic
1006398508 6:33802281-33802303 GCCAGGCCTCCAAGCAGGGAGGG + Intronic
1006691497 6:35891427-35891449 ACATGGAGGCCAGGCATGGATGG + Intronic
1006766370 6:36510226-36510248 AGAGGGAGGCCAAGCAGGGGAGG - Intronic
1013054292 6:106568326-106568348 TCAAGGAGGCAAGGCAGGGAGGG - Intronic
1016218427 6:141632825-141632847 TCAAGGAAACCAATCAGGGATGG - Intergenic
1018883317 6:167907063-167907085 ACAGGGCTGCCAAGCAGGGCAGG - Intronic
1019725995 7:2603023-2603045 ACCAGGAGGCCAGGCACGGAGGG - Intronic
1019912920 7:4112218-4112240 AGGAAGACTCCAAGCAGGGAGGG + Intronic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1022373741 7:29793870-29793892 ACAAGGAAGCAAAGAGGGGATGG - Intergenic
1023033705 7:36112302-36112324 TCAAGGTAACCAAGCAGGGATGG - Intergenic
1023366437 7:39468906-39468928 AGAAGGAAGCCAAGCAGGACAGG - Intronic
1023742733 7:43294983-43295005 AGGACAACGCCAAGCAGGGAGGG + Intronic
1024874484 7:54006219-54006241 CCAATTACACCAAGCAGGGATGG + Intergenic
1029412858 7:100426879-100426901 AGAAGGAGGGGAAGCAGGGAAGG - Intronic
1034677185 7:152900409-152900431 ACACAGACACCCAGCAGGGAGGG - Intergenic
1034973227 7:155432125-155432147 AGAAGGAAGCACAGCAGGGAAGG + Intergenic
1039194989 8:35021104-35021126 AACAGGAAGCCAAGCAGAGATGG + Intergenic
1039860754 8:41455098-41455120 ACAACGAGGGCAAGCAGGGTTGG - Intergenic
1041311684 8:56523912-56523934 AAAAGGAAGGAAAGCAGGGAAGG - Intergenic
1043379124 8:79684027-79684049 AAAAGCATCCCAAGCAGGGAGGG - Intergenic
1044119978 8:88382541-88382563 ACAAGGAAGGAAAGAAGGGAAGG - Intergenic
1044136162 8:88588747-88588769 ACAGGGTCACCAAGCAGGCAAGG + Intergenic
1044697517 8:94937691-94937713 ACAAGTACTGGAAGCAGGGATGG + Intronic
1045692446 8:104773788-104773810 ATGGGGACACCAAGCAGGGAAGG - Intronic
1047716923 8:127604135-127604157 ACAAGTACCAGAAGCAGGGATGG - Intergenic
1049571107 8:143370719-143370741 CCAAGGCTGCCAAGCTGGGAAGG + Intronic
1051038290 9:12775910-12775932 AGGAGGACGACAAGGAGGGAGGG - Exonic
1056737832 9:89224977-89224999 CCAAGGAAGGCCAGCAGGGAGGG - Intergenic
1057842437 9:98496722-98496744 ACAAGGAGGCCAGACAGGGAAGG + Intronic
1058737277 9:107905245-107905267 ACAAGGATGCCAACCACAGAAGG - Intergenic
1059315410 9:113421308-113421330 AGCAGGAGGCCAAGCAGAGAAGG + Intronic
1059614365 9:115932660-115932682 CCAAGGTCACCAAGCTGGGATGG + Intergenic
1061922199 9:133788348-133788370 ACAAGGACGTCAAGAAGGTGGGG - Exonic
1186194543 X:7097999-7098021 TCAACGAAGCCGAGCAGGGATGG + Intronic
1193911756 X:87315033-87315055 AAAAAGACTCCAAGTAGGGAGGG - Intergenic
1195104908 X:101594128-101594150 ACCAGGGGGCCAAGCAGGGATGG - Intergenic
1195128984 X:101836683-101836705 ACACTGACCCCAAGCTGGGATGG + Intronic
1195153064 X:102094029-102094051 AGAAGCATGCCATGCAGGGAAGG + Intergenic
1195708840 X:107758112-107758134 AGAAGGAGGGCTAGCAGGGAGGG + Intronic
1197267033 X:124385801-124385823 ACAAGTACACCAAGCAAGCAAGG - Exonic
1201297594 Y:12477588-12477610 AGGAAGACTCCAAGCAGGGAGGG - Intergenic
1201728579 Y:17182231-17182253 ACAAGGAAGGAAAGGAGGGAAGG - Intergenic