ID: 1147418953

View in Genome Browser
Species Human (GRCh38)
Location 17:40312509-40312531
Sequence CTGCACGTCCCTCCTGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 189}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147418953_1147418965 16 Left 1147418953 17:40312509-40312531 CCCCTGGCAGGAGGGACGTGCAG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1147418965 17:40312548-40312570 CAGAGGGGCTGGCCAAGGTGAGG 0: 1
1: 0
2: 6
3: 48
4: 465
1147418953_1147418963 5 Left 1147418953 17:40312509-40312531 CCCCTGGCAGGAGGGACGTGCAG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1147418963 17:40312537-40312559 CACGGGGCAGGCAGAGGGGCTGG 0: 1
1: 0
2: 9
3: 93
4: 789
1147418953_1147418964 11 Left 1147418953 17:40312509-40312531 CCCCTGGCAGGAGGGACGTGCAG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1147418964 17:40312543-40312565 GCAGGCAGAGGGGCTGGCCAAGG 0: 1
1: 0
2: 15
3: 104
4: 862
1147418953_1147418961 0 Left 1147418953 17:40312509-40312531 CCCCTGGCAGGAGGGACGTGCAG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1147418961 17:40312532-40312554 AAAAGCACGGGGCAGGCAGAGGG 0: 1
1: 0
2: 3
3: 26
4: 303
1147418953_1147418960 -1 Left 1147418953 17:40312509-40312531 CCCCTGGCAGGAGGGACGTGCAG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1147418960 17:40312531-40312553 GAAAAGCACGGGGCAGGCAGAGG 0: 1
1: 0
2: 3
3: 44
4: 339
1147418953_1147418969 29 Left 1147418953 17:40312509-40312531 CCCCTGGCAGGAGGGACGTGCAG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1147418969 17:40312561-40312583 CAAGGTGAGGGTAAGCAGGCAGG 0: 1
1: 0
2: 0
3: 24
4: 262
1147418953_1147418967 25 Left 1147418953 17:40312509-40312531 CCCCTGGCAGGAGGGACGTGCAG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1147418967 17:40312557-40312579 TGGCCAAGGTGAGGGTAAGCAGG 0: 1
1: 1
2: 2
3: 14
4: 220
1147418953_1147418966 17 Left 1147418953 17:40312509-40312531 CCCCTGGCAGGAGGGACGTGCAG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1147418966 17:40312549-40312571 AGAGGGGCTGGCCAAGGTGAGGG 0: 1
1: 0
2: 3
3: 36
4: 446
1147418953_1147418962 1 Left 1147418953 17:40312509-40312531 CCCCTGGCAGGAGGGACGTGCAG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1147418962 17:40312533-40312555 AAAGCACGGGGCAGGCAGAGGGG 0: 1
1: 0
2: 1
3: 37
4: 555
1147418953_1147418959 -7 Left 1147418953 17:40312509-40312531 CCCCTGGCAGGAGGGACGTGCAG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 1147418959 17:40312525-40312547 CGTGCAGAAAAGCACGGGGCAGG 0: 1
1: 0
2: 1
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147418953 Original CRISPR CTGCACGTCCCTCCTGCCAG GGG (reversed) Intronic
900242489 1:1623707-1623729 CTGCCCGTCCCGCCTGCCCTTGG - Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900414559 1:2529060-2529082 CGGCACAGCCCGCCTGCCAGGGG + Exonic
901050889 1:6425369-6425391 CTGCACGGAGCTCCTTCCAGAGG + Intronic
902082874 1:13833259-13833281 CTTCACATTCCTCCTGCCTGAGG - Intergenic
902607751 1:17578248-17578270 CTGCACGGCACTCCTGCTACAGG - Intronic
905171912 1:36114687-36114709 CCACACCTCCCTCCTGCCTGAGG + Intronic
906776894 1:48537926-48537948 CAGCACTTCCCTCCTGTCAGGGG + Intronic
906913060 1:49977238-49977260 CTTCACCTCCCTTCTTCCAGAGG + Intronic
907514090 1:54982229-54982251 CCCCACCTCCCTCCAGCCAGAGG - Intronic
912950695 1:114118428-114118450 CTGGACGGCCCTGGTGCCAGGGG + Intronic
916659062 1:166904322-166904344 CTGAACCTGCCCCCTGCCAGTGG + Intergenic
921706226 1:218324521-218324543 CTGCACCTCCCTGCTGCAACTGG + Intronic
921924452 1:220699876-220699898 CTGCACGTTGCATCTGCCAGTGG + Intergenic
922188923 1:223300031-223300053 CTGAATGTCCCTCCACCCAGAGG + Intronic
924811872 1:247410023-247410045 CTGCTCTTCCCTCTTTCCAGGGG - Intergenic
1069615449 10:69803448-69803470 CTGCATGTCCCTCCTTCCTGGGG - Intronic
1071293990 10:84206149-84206171 CTGCAGGTGCATGCTGCCAGAGG + Intronic
1074896854 10:117784673-117784695 CTGCAGGTGTCTCCTGTCAGAGG - Intergenic
1075413874 10:122248623-122248645 CTCCTGGTCTCTCCTGCCAGAGG + Exonic
1075475118 10:122727687-122727709 CTTCAGGTCCCACCTGCCCGCGG - Intergenic
1076822226 10:132945227-132945249 CACCACGTCCCTCCTGCCCCCGG - Intergenic
1077487821 11:2847151-2847173 CTGCAAGCCCCTCCTGGAAGTGG + Intronic
1078637958 11:13069449-13069471 CTGCAGATGCCTCCTGCCAGGGG + Intergenic
1080857104 11:36121844-36121866 CAGCACCTCCCACCTGCCATCGG + Intronic
1084321121 11:68373873-68373895 CTGCACATCCCTCCTGCTTGGGG + Intronic
1084430131 11:69106419-69106441 CTGCCCCTCCCCACTGCCAGTGG - Intergenic
1084692523 11:70735308-70735330 CTGCACATCCCTCCTCCCCGAGG - Intronic
1085743966 11:79099198-79099220 CTGGATTCCCCTCCTGCCAGGGG + Intronic
1086120913 11:83303831-83303853 CTGAATGTCCCTCCTGCCCCAGG - Intergenic
1088541569 11:110919051-110919073 ATGCACGCCCCTCCTGCCTCTGG - Intergenic
1089661070 11:119985692-119985714 CTGCACGTCCCTGGTGGCGGAGG - Intergenic
1090910251 11:131111949-131111971 CTGCACGTTCCTGGAGCCAGTGG - Intergenic
1091361264 11:134980257-134980279 CTGCACGTCTCACATCCCAGTGG - Intergenic
1092132333 12:6121204-6121226 CTGCAGTTACCTCCTGGCAGGGG - Exonic
1092894908 12:13001546-13001568 CTGCTCTTTCCTCCTGCCGGAGG + Intergenic
1094151553 12:27290002-27290024 CTGCTCATCCCTCCTGCCTTGGG - Intronic
1096142575 12:49254605-49254627 GTGCACAACCCTCCTGCAAGTGG + Intronic
1096146523 12:49282590-49282612 CTGCCCTCCCCTCCAGCCAGGGG + Intergenic
1098633902 12:72757464-72757486 CTGCCAGTGGCTCCTGCCAGTGG - Intergenic
1103969402 12:124660658-124660680 CTCCCCGCCCCTCCTGCCACTGG + Intergenic
1104728027 12:131089545-131089567 CTGCAAGTGCTCCCTGCCAGTGG + Intronic
1104736311 12:131137779-131137801 CTGCACTGCCTTCCTGCCACCGG - Intronic
1104980873 12:132572632-132572654 GTGCCCGCCCCACCTGCCAGGGG - Intronic
1105892405 13:24690926-24690948 CTGCACACCCCTCCTGGCTGAGG + Intronic
1107869278 13:44732335-44732357 CTGCCAGTCCCTCCTGCTACGGG - Intergenic
1112285827 13:98103606-98103628 CTCCTCTACCCTCCTGCCAGAGG + Intergenic
1112441242 13:99426437-99426459 CTGCACCCCTCTCCTGCCACTGG + Intergenic
1118502791 14:66378848-66378870 CTGCATGTCCCTCTTGCAAAGGG + Intergenic
1118884141 14:69852635-69852657 CTGCAACTCCCTCCTGCCCTGGG + Intergenic
1119653163 14:76397856-76397878 ATGCACATACCTCCTGCCACAGG - Intronic
1121693162 14:95892296-95892318 CTTCATGTCCCTCCTGGCAGAGG - Intergenic
1122125312 14:99575600-99575622 CTGTATGTCCCACCTGCCGGAGG + Intronic
1122341861 14:101033727-101033749 GAGCACGTCCTCCCTGCCAGAGG - Intergenic
1123964146 15:25438719-25438741 CTGAGGGGCCCTCCTGCCAGGGG + Exonic
1124121591 15:26893498-26893520 CTGGACCTCCCTCCTGCGTGTGG + Intronic
1124385502 15:29205041-29205063 CTCCAGGTACCTCCTGCAAGTGG + Intronic
1126461205 15:48916912-48916934 CTGGAGGTCCCTTCTGCCAATGG + Intronic
1127297277 15:57619959-57619981 TTTCAGGTCCCTCCTGCCATAGG + Intronic
1127611218 15:60639475-60639497 CTCCACGTCCCGGCTTCCAGTGG + Intronic
1128342166 15:66830199-66830221 ATGGGGGTCCCTCCTGCCAGAGG + Intergenic
1130925743 15:88384364-88384386 CTGCAGTGCCCTCCTGGCAGAGG - Intergenic
1131881602 15:96868105-96868127 CTGCACGTTCCCTCTGCTAGGGG + Intergenic
1132400526 15:101502174-101502196 CCCCAGGCCCCTCCTGCCAGGGG + Intronic
1132704477 16:1237177-1237199 CTCCAGCTCCCTCCTCCCAGAGG - Intergenic
1132707037 16:1249248-1249270 CTCCAGCTCCCTCCTCCCAGAGG + Intergenic
1132966095 16:2655469-2655491 CTGCTTTTCCCTCCTGACAGCGG - Intergenic
1133201319 16:4206377-4206399 CTGCACGTCCCTCCACCCGCTGG + Intronic
1133546605 16:6813761-6813783 CTGCAGGTGCCTGCTGCCATTGG - Intronic
1135525650 16:23211951-23211973 CTGCACATCCCTCAGCCCAGGGG - Intronic
1137609413 16:49808978-49809000 GGGGACGTGCCTCCTGCCAGGGG - Intronic
1138239673 16:55417288-55417310 CTACACATGCCTCTTGCCAGTGG + Intronic
1138389882 16:56662722-56662744 ATGCACCTCCCTCCTGCCCCGGG + Intronic
1138391912 16:56676280-56676302 ATGCACCTCCCTCCTGCCCCGGG - Intronic
1141427880 16:83955395-83955417 CTGCACGTTCCACCCGGCAGAGG + Intronic
1141586613 16:85038073-85038095 CTGCAAGTCCCTGCTTCCATGGG + Intronic
1145209823 17:21004679-21004701 TGGAACCTCCCTCCTGCCAGAGG + Intronic
1147324203 17:39662640-39662662 CAGCATGTTCTTCCTGCCAGGGG + Intronic
1147418953 17:40312509-40312531 CTGCACGTCCCTCCTGCCAGGGG - Intronic
1147873088 17:43601516-43601538 CTGCAGGCCGCTCCTGGCAGGGG + Intergenic
1151936696 17:77266351-77266373 CTCCACATCCCTCCTTGCAGGGG - Intergenic
1152461882 17:80445915-80445937 CTGCAGGGGCCTCCTGCCAGGGG + Intergenic
1152611887 17:81319235-81319257 GTGCACATCCCTCCTGCCCAGGG + Intronic
1153658724 18:7307774-7307796 CTGCAGCTGCCTCCTGCCAAGGG + Intergenic
1153698533 18:7668635-7668657 ATGCAGCTGCCTCCTGCCAGTGG + Intronic
1154494034 18:14942633-14942655 CTGCACGTCTCACATCCCAGTGG + Intergenic
1155097341 18:22570732-22570754 CTTCACATCCCTCCTGCAGGTGG + Intergenic
1160014038 18:75127379-75127401 CCGCACCTCCCTCCTGGCACAGG - Intergenic
1160591628 18:79947975-79947997 CTGGGCGTCCCTCCAGCCTGAGG - Intronic
1161454461 19:4363110-4363132 CTGCACGTTGCTGCTGCCACAGG - Intronic
1161558656 19:4958377-4958399 GAGCACCTCCTTCCTGCCAGAGG - Intronic
1162121691 19:8473842-8473864 CTGCCTGTCCATCCTTCCAGCGG + Intronic
1162769563 19:12940878-12940900 CTCCAAGTCTCACCTGCCAGAGG - Exonic
1164051406 19:21587736-21587758 CCCCACCTCCCTCCAGCCAGGGG - Intergenic
1164732877 19:30519324-30519346 CTTCCAGTCCCTCCTGCCACAGG - Intronic
1165041582 19:33071790-33071812 CTGCACTGCACTCCAGCCAGGGG - Intergenic
1166795123 19:45421233-45421255 TTGGGCGTCTCTCCTGCCAGGGG + Exonic
1166876508 19:45901275-45901297 CTGCACGTCGGTCCTCCCGGCGG + Exonic
1167112588 19:47470980-47471002 CTCCAGGTCCCCCCTGCCAGGGG + Intronic
1168244293 19:55103427-55103449 CTGCACGTGGCTGCTGCCAAGGG - Exonic
925207810 2:2022080-2022102 CTGCACTTCCCTCGGGCAAGTGG + Intronic
925868686 2:8250903-8250925 CTGGAGGTGTCTCCTGCCAGAGG + Intergenic
926303650 2:11621597-11621619 CTCCTCATCCCTCCTCCCAGTGG + Intronic
928165798 2:28970994-28971016 CTGCACGCCTCTCCTTCCTGGGG + Intronic
929541699 2:42828032-42828054 GTCCATGTCCCTCCTGACAGCGG - Intergenic
929587823 2:43127211-43127233 CTGCACGTCCCTCCTCCGATAGG + Intergenic
931053716 2:58443474-58443496 GGGCAGGTGCCTCCTGCCAGAGG - Intergenic
934853887 2:97717332-97717354 CCGCATGTCCCCCCAGCCAGAGG - Intronic
934853901 2:97717382-97717404 CCGCATGTCCCCCCAGCCAGAGG - Intronic
936160984 2:110084199-110084221 CTGCACGTGCCTTCTGTCATTGG - Exonic
936183679 2:110287155-110287177 CTGCACGTGCCTTCTGTCATTGG + Intergenic
937836130 2:126471929-126471951 GGGCAGGTCCCACCTGCCAGAGG - Intergenic
938408613 2:131046212-131046234 CTGCTGGGCCTTCCTGCCAGTGG + Exonic
938459784 2:131490107-131490129 CTGCATGAGCCTCCTGACAGCGG - Intronic
941228348 2:162877318-162877340 CTGCCCATCCCTCCTGCAAAAGG - Intergenic
943039451 2:182786947-182786969 TTGCTCGTCCCTTCTGCCATGGG + Exonic
946848887 2:223885828-223885850 CAGCACGTCCCTCCCTCCTGGGG + Intronic
948635051 2:239329486-239329508 CTGCACACCCCTCCTCCCACCGG + Intronic
948814759 2:240504202-240504224 CTGCAGGACCCTTCTGCTAGAGG - Intronic
1173424620 20:42932060-42932082 CTGCAAGTTCATCCTGTCAGAGG + Intronic
1173859565 20:46273946-46273968 CTGCTCTTCCCTCCTCCCAGTGG - Intronic
1175787309 20:61720130-61720152 CTGCAGGGCCCTCCTGCCTTCGG + Intronic
1175893063 20:62323775-62323797 ATGCAGGTGCCTCCTGCGAGCGG - Exonic
1178376215 21:32069802-32069824 CTTCACATCGCTCCTTCCAGGGG - Intergenic
1179437015 21:41369177-41369199 CTGCACCCCCCTCCTCCCATGGG - Intronic
1180787372 22:18554477-18554499 CTGCCCGGGCCTGCTGCCAGGGG - Intergenic
1180955914 22:19741135-19741157 CTCCAAGTGGCTCCTGCCAGTGG - Intergenic
1181234367 22:21440828-21440850 CTGCCCGGGCCTGCTGCCAGGGG + Intronic
1181244281 22:21494003-21494025 CTGCCCGGGCCTGCTGCCAGGGG - Intergenic
1183513981 22:38252545-38252567 CTCCAGGTCACTCCTGCCTGTGG - Intronic
1184204680 22:42994511-42994533 GTGCACGTGCCTCCAGCCAAAGG - Intronic
1184684424 22:46089740-46089762 CTGCCCCTGCCTCCTGCCCGAGG + Intronic
949235883 3:1807695-1807717 CTCCACGTACCTAGTGCCAGTGG - Intergenic
950106529 3:10392372-10392394 CTCCCAGGCCCTCCTGCCAGGGG + Intronic
954594737 3:51814655-51814677 CTGCACCTCACTCCTCCAAGGGG + Intergenic
955886759 3:63607708-63607730 CTGCAAGTCACTCCATCCAGTGG - Intronic
960235970 3:115282623-115282645 GTGGCCGTCCCTCCTGCCACTGG + Intergenic
965985693 3:174750506-174750528 CTGCAACTTCCACCTGCCAGGGG + Intronic
967612432 3:191523478-191523500 CTGCACTTCCATCCTGCCCCAGG + Intergenic
967719339 3:192798971-192798993 CTGCACCTCGCTCCTGGCAAAGG + Exonic
968609211 4:1549497-1549519 CTGCCCATCCCTCCTGCCTGGGG - Intergenic
968629948 4:1645174-1645196 AAGCACCTCCCTCCTGCCACAGG + Intronic
968918256 4:3507334-3507356 TTGCACTTCCCTGGTGCCAGAGG - Exonic
968973283 4:3807562-3807584 TAGCACCTCCCTGCTGCCAGAGG - Intergenic
970963221 4:21897909-21897931 CACCACGTGCCTGCTGCCAGGGG - Intronic
973293173 4:48490163-48490185 CTCCACGCCCTTCCTGCCACCGG - Intergenic
978770501 4:112451734-112451756 CTCCACATCCCTGCTGGCAGGGG - Intergenic
980495508 4:133584757-133584779 CTGCATGCTCCTCCTGCAAGGGG + Intergenic
982353501 4:154442613-154442635 CCCCACATCCCTACTGCCAGTGG + Intronic
985633754 5:1026220-1026242 CTGCTCTTCCCACCTGCTAGTGG + Intronic
985971496 5:3381787-3381809 CAGCCCGTCCCTGCAGCCAGGGG + Intergenic
988407278 5:30839996-30840018 CCCCACATCCCTCCTGCCAACGG + Intergenic
990003672 5:50922348-50922370 CTGCCCATCCCTCCTGCCTGGGG + Intergenic
992157461 5:73969351-73969373 CTGCACTTCTCTGCTCCCAGGGG - Intergenic
999175261 5:149627543-149627565 CTGCAAGGCCCTCCAGGCAGGGG - Intronic
1001980819 5:176035974-176035996 CTGCACTGCCCTCCTGCAGGGGG - Intergenic
1002236643 5:177808091-177808113 CTGCACTGCCCTCCTGCAGGGGG + Intergenic
1006081232 6:31568175-31568197 CTCCATGTCCCTCCTGCCTTAGG + Intergenic
1007777821 6:44233575-44233597 CTGCCCCTTCCTTCTGCCAGGGG + Exonic
1009034133 6:58096002-58096024 CTCCTCTGCCCTCCTGCCAGTGG - Intergenic
1009209741 6:60847707-60847729 CTCCTCTGCCCTCCTGCCAGTGG - Intergenic
1017826494 6:158085856-158085878 CTGCACGTTGCTCCTGCCAGGGG + Intronic
1018651770 6:165998437-165998459 CTTCATTTCCCTCCTACCAGTGG - Intergenic
1018903933 6:168064414-168064436 CTCCATGGCCCTCCTCCCAGGGG + Intronic
1019290164 7:246337-246359 CAGCACGTCCCGCCTGCCTCCGG + Intronic
1019737562 7:2658266-2658288 CTGCGTGTCCCTCCTCACAGAGG + Exonic
1020153848 7:5705565-5705587 CTGCACATCCCTCTTGGCAGAGG + Intronic
1021776562 7:24060038-24060060 CAGCACATCCCTTCTGCCAAGGG + Intergenic
1022479323 7:30732904-30732926 CTGGCTGTGCCTCCTGCCAGAGG + Intronic
1022579399 7:31534152-31534174 CTCCACAACCCTCCTTCCAGTGG + Intronic
1023269828 7:38450439-38450461 CAGCTGGTCCCTTCTGCCAGAGG - Intronic
1023761157 7:43466368-43466390 CTGTACTTCGCTCCTGACAGTGG - Intronic
1023909025 7:44540944-44540966 CTCCAAGTCCCTCCTGTCACTGG - Intronic
1024292125 7:47812288-47812310 CTCCAGGTCCCTCCTGCCTGAGG - Intronic
1024529431 7:50379175-50379197 CTGCACTGCCCTGCTGCCTGAGG - Intronic
1024548474 7:50541175-50541197 CTCCATGTCCATCCTGCCTGTGG + Intronic
1025813154 7:64888221-64888243 CTGCCCCACCCTCCAGCCAGAGG + Intronic
1029190464 7:98768124-98768146 CTCAACTTCCCTCCTGCCGGCGG - Intergenic
1035184287 7:157113729-157113751 CACCAAGTCCCTCCTGCCACAGG - Intergenic
1035187167 7:157135551-157135573 CTGTTTGTCCCTCCTGCCATGGG - Intergenic
1039461388 8:37748375-37748397 CGGCACCTCACACCTGCCAGGGG - Intronic
1041117469 8:54554258-54554280 CTGCACCTCCCTCCTGTGAGAGG + Intergenic
1044611679 8:94098095-94098117 CTGCACCTCCCTCCACTCAGAGG - Intergenic
1046912320 8:119641967-119641989 CTGCAAGTTCCTCCTCTCAGTGG - Intronic
1047780178 8:128104782-128104804 ATGCAGGTCCCTTCTGTCAGAGG + Intergenic
1049589570 8:143450884-143450906 CTGCAGGACGCTCCTGGCAGGGG + Intronic
1056376823 9:86022780-86022802 TTGCAAGTGCCTGCTGCCAGAGG + Intergenic
1056548800 9:87634877-87634899 CTGCACACCCCTGCTGCCATGGG + Intronic
1057627289 9:96688757-96688779 CTGCAGTTCCCTCTTGCTAGGGG + Intergenic
1060258556 9:122053772-122053794 GTGCCCTTCCCTCCTGCCCGTGG + Intronic
1060544153 9:124450585-124450607 CTGCGCGTCCCTCCTCCGCGAGG - Intergenic
1061416409 9:130449484-130449506 CTGCTCCTGCCTCCTCCCAGAGG - Intronic
1061445174 9:130633488-130633510 CTGCCCGTTCCACCCGCCAGGGG - Intronic
1061588758 9:131584675-131584697 CTGTACGACCCCCATGCCAGTGG + Intronic
1061862040 9:133473107-133473129 CACCAAGTCCTTCCTGCCAGTGG - Exonic
1061897549 9:133656337-133656359 CTGCCTGTCTCTCCTGCCAATGG + Intronic
1062284890 9:135768501-135768523 CTGCACCAGCCTCCTCCCAGAGG + Intronic
1062646888 9:137552215-137552237 CTGCACGAACCTCCAGCCCGAGG - Exonic
1189494897 X:41499938-41499960 CTGCACTGTCCTCCTGCCACAGG - Intergenic
1190581612 X:51896460-51896482 CTCCAGGTCCCTGCAGCCAGTGG - Exonic
1191669987 X:63740066-63740088 CTGTACCTGCCACCTGCCAGAGG - Intronic
1192576842 X:72249756-72249778 CTGCCCTTCACCCCTGCCAGAGG - Intronic
1198279878 X:135131156-135131178 CTGCCTGTCCCCCTTGCCAGGGG + Intergenic
1198291079 X:135241358-135241380 CTGCCTGTCCCCCTTGCCAGGGG - Intergenic
1202372117 Y:24205672-24205694 CTTCGCGCCCCACCTGCCAGAGG - Intergenic
1202498668 Y:25464444-25464466 CTTCGCGCCCCACCTGCCAGAGG + Intergenic