ID: 1147419551

View in Genome Browser
Species Human (GRCh38)
Location 17:40315581-40315603
Sequence GCCCTCCAAGACCATGGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147419551_1147419556 28 Left 1147419551 17:40315581-40315603 CCCGCACCATGGTCTTGGAGGGC 0: 1
1: 0
2: 0
3: 10
4: 224
Right 1147419556 17:40315632-40315654 ATCACTTAATGCTGTTCTTCAGG 0: 1
1: 0
2: 0
3: 19
4: 205
1147419551_1147419555 2 Left 1147419551 17:40315581-40315603 CCCGCACCATGGTCTTGGAGGGC 0: 1
1: 0
2: 0
3: 10
4: 224
Right 1147419555 17:40315606-40315628 ATTGCTTCTCATCATCTCTTCGG 0: 1
1: 0
2: 2
3: 27
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147419551 Original CRISPR GCCCTCCAAGACCATGGTGC GGG (reversed) Intronic
901100802 1:6717111-6717133 CAACTCCAAGACCATGGCGCTGG + Intergenic
902450153 1:16491525-16491547 GCCCTCCAAGCCCAGGGGGTGGG + Intergenic
902502689 1:16921623-16921645 GCCCTCCAAGCCCAGGGGGTGGG - Intronic
903073191 1:20739008-20739030 GTCCTCAAAGACCACCGTGCAGG + Intergenic
903121098 1:21217593-21217615 GGGGTCCAAGCCCATGGTGCTGG + Intronic
903999210 1:27328948-27328970 GCCCTACAGGACCTGGGTGCTGG - Intronic
904013270 1:27402410-27402432 TCCCTCCTAGATCATGGGGCTGG - Intergenic
905198025 1:36296360-36296382 GTCCTCCAAAACAATGATGCTGG - Intronic
913666849 1:121056739-121056761 GCCCTCCTGGACCATGGTAAGGG - Intergenic
914018593 1:143844175-143844197 GCCCTCCTGGACCATGGTAAGGG - Intergenic
914356096 1:146885832-146885854 GTTCTCCAAGTTCATGGTGCGGG - Intergenic
914657148 1:149752378-149752400 GCCCTCCTGGACCATGGTAAGGG - Intergenic
916247577 1:162704545-162704567 GACGTCCAAGATCAAGGTGCTGG + Intronic
916648937 1:166816953-166816975 GCCCTCCCACTCCATGGAGCAGG - Intergenic
918402078 1:184173589-184173611 GAACTCCAAGATCAAGGTGCCGG - Intergenic
919988644 1:202693346-202693368 ACCCTTCAAGACCATGGGGAAGG + Intronic
920515165 1:206579933-206579955 GCCATCCCAGACCTGGGTGCTGG + Intronic
920746671 1:208635579-208635601 GCCATCCAGGACCGAGGTGCTGG + Intergenic
921755750 1:218854193-218854215 GCAGTCCAAGAGTATGGTGCTGG - Intergenic
922279178 1:224106563-224106585 GCCCTCCAAGATCTGGGTCCTGG - Intergenic
923741435 1:236658471-236658493 GCAGTCCAAGATCAAGGTGCCGG - Intergenic
1063382235 10:5592697-5592719 GCCCTTCAGGGCCACGGTGCAGG + Intergenic
1065165985 10:22977520-22977542 AACCTGCAAGACCATGGTGAAGG - Intronic
1066043556 10:31577418-31577440 GAAGTCCAAGAGCATGGTGCCGG - Intergenic
1067449191 10:46370989-46371011 GCCCTCCCAGTCCAGGGTGAGGG - Intronic
1067449203 10:46371029-46371051 GCCCTCCCAGTCCAGGGTGAGGG - Intronic
1067588167 10:47489736-47489758 GCCCTCCCAGTCCAGGGTGAGGG + Intronic
1067588179 10:47489776-47489798 GCCCTCCCAGTCCAGGGTGAGGG + Intronic
1067635291 10:47997827-47997849 GCCCTCCCAGTCCAGGGTGAGGG + Intergenic
1067635303 10:47997867-47997889 GCCCTCCCAGTCCAGGGTGAGGG + Intergenic
1068974087 10:62989478-62989500 GAGTTCCAAGACCATGGTGGTGG - Intergenic
1069696916 10:70393354-70393376 GAAGTCCAAGACCAAGGTGCTGG + Intergenic
1070689347 10:78512966-78512988 GCCCTCCTAGATTATGGAGCTGG - Intergenic
1071609824 10:87022203-87022225 GCCCTCCCAGTCCAGGGTGAGGG - Intronic
1071609836 10:87022243-87022265 GCCCTCCCAGTCCAGGGTGAGGG - Intronic
1072192867 10:93090394-93090416 GAAGTCCAAGACCAAGGTGCTGG + Intergenic
1072568511 10:96638328-96638350 GAAGTCCAAGAGCATGGTGCTGG - Intronic
1075763647 10:124875832-124875854 GCCCTCCTAGTCCATGTGGCTGG - Intergenic
1077309971 11:1883960-1883982 CCCCTCCAAGACCAAGGGGCTGG - Exonic
1079663966 11:23080531-23080553 GAGGTCCAAGAGCATGGTGCTGG + Intergenic
1080947389 11:36989422-36989444 TCCCAACCAGACCATGGTGCAGG + Intergenic
1083596924 11:63922137-63922159 GAAGTCCAAGAGCATGGTGCTGG - Intergenic
1083962551 11:66022465-66022487 GCCCTCCAACGCCGTGGAGCAGG - Intronic
1084223284 11:67698042-67698064 GAAGTCCAAGAGCATGGTGCTGG - Intergenic
1084682270 11:70673434-70673456 GCCCACAAAGACCATGCTGGCGG + Intronic
1085757892 11:79216745-79216767 GAAATCCAAGAGCATGGTGCTGG - Intronic
1086381959 11:86263733-86263755 GAAGTCCAAGAACATGGTGCCGG + Intronic
1086972463 11:93098310-93098332 GAAGTCCAAGAGCATGGTGCCGG - Intergenic
1087149331 11:94844526-94844548 GAAGTCCAAGAGCATGGTGCTGG + Intronic
1088724545 11:112622554-112622576 GACGTCCAAGATCAAGGTGCTGG - Intergenic
1089132146 11:116220546-116220568 GAACTCCAAGATCAAGGTGCTGG - Intergenic
1091563375 12:1630575-1630597 GCCCTCGAGGACCACGGTGCCGG + Intronic
1094413043 12:30188551-30188573 CTCCTCCAAGTACATGGTGCAGG - Intergenic
1097871997 12:64610075-64610097 CCCCTACAGGACCCTGGTGCGGG + Intergenic
1098164228 12:67677175-67677197 GAACTCCAAGATCAAGGTGCTGG + Intergenic
1102750816 12:115292440-115292462 GAAATCCAAGACCAAGGTGCTGG + Intergenic
1103998245 12:124843725-124843747 GCCCTCCAAGCCCAAGCTGGTGG + Intronic
1104571867 12:129933191-129933213 GAAGTCCAAGACCAAGGTGCTGG + Intergenic
1104732321 12:131114620-131114642 GCCCACCCAGAGCATGGTGGGGG + Intronic
1105489553 13:20874650-20874672 GAAGTCCAAGAGCATGGTGCCGG - Intronic
1107421336 13:40249699-40249721 GAAGTCCAAGAGCATGGTGCTGG + Intergenic
1107793788 13:44029510-44029532 GACCTCCAAGATCAAGGTGCAGG - Intergenic
1111918655 13:94387836-94387858 GGTGTCCAAGACCAAGGTGCTGG - Intronic
1112459668 13:99592433-99592455 GAAGTCCAAGAACATGGTGCTGG + Intergenic
1113003715 13:105675396-105675418 GAAATCCAAGACCACGGTGCTGG + Intergenic
1114775447 14:25475755-25475777 GCCCCCCAACACCCTGGTGATGG + Intergenic
1116274084 14:42807969-42807991 GGCCTACAAGACCATGGTCAGGG - Intergenic
1117950097 14:61074381-61074403 GAAGTCCAAGAACATGGTGCTGG + Intronic
1118071360 14:62249810-62249832 CCCCTGCAAGATCAAGGTGCTGG + Intergenic
1118760953 14:68879897-68879919 GCCCTCCAGGGCCCTGGGGCAGG + Intronic
1122281793 14:100627921-100627943 GAAGTCCAAGACCAAGGTGCTGG + Intergenic
1124515931 15:30367493-30367515 GCCCACGATGATCATGGTGCTGG + Exonic
1124726989 15:32163238-32163260 GCCCACGATGATCATGGTGCTGG - Exonic
1125033611 15:35097756-35097778 GACGTCCAAGATCAAGGTGCTGG - Intergenic
1127265829 15:57360818-57360840 GAAGTCCAAGACCAGGGTGCTGG + Intergenic
1127972628 15:63973380-63973402 GCCCTCCAGGCCCATGGGGGTGG - Intronic
1129471990 15:75761277-75761299 GTCCTCCAAGGCCTTGGTGTAGG - Intergenic
1132695579 16:1200393-1200415 GGCCTCCCAGCCCAGGGTGCAGG - Exonic
1135683084 16:24475436-24475458 GAACTCCAAGATCAAGGTGCCGG + Intergenic
1136570229 16:31092462-31092484 GTCAGCCAGGACCATGGTGCTGG + Intronic
1137963855 16:52911832-52911854 GGCCTCATTGACCATGGTGCTGG - Intergenic
1138834451 16:60416697-60416719 GCCCTGCAAGACCTTGCTTCTGG - Intergenic
1139279156 16:65754877-65754899 GAACTCCAAGATCAAGGTGCTGG - Intergenic
1139977919 16:70829630-70829652 GTTCTCCAAGTTCATGGTGCGGG + Exonic
1140281424 16:73558410-73558432 GCCCTCCCACCACATGGTGCTGG - Intergenic
1141795297 16:86269019-86269041 GAAATCCAAGAGCATGGTGCTGG + Intergenic
1141873193 16:86803721-86803743 GCAATCCAAGATCAAGGTGCCGG + Intergenic
1141904067 16:87011429-87011451 GCCCTCGGAGACGATGGTGCAGG + Intergenic
1142174674 16:88639615-88639637 GCCCTCCAAGAGCACAGAGCAGG - Intronic
1142906214 17:3044058-3044080 GCCCTGAAAGAACCTGGTGCTGG - Intergenic
1143370965 17:6439173-6439195 GAAATCCAAGAGCATGGTGCTGG + Intergenic
1144668119 17:17115827-17115849 GGCCACCAAGTCCATGGTGTTGG - Intronic
1145288798 17:21526663-21526685 GAATTCCAAGACCAAGGTGCGGG - Intronic
1145963137 17:28898848-28898870 GCCATCCAGGAACATGGCGCAGG + Exonic
1147419551 17:40315581-40315603 GCCCTCCAAGACCATGGTGCGGG - Intronic
1148730911 17:49835846-49835868 GCCCTCCAAGACAAGGGAGGAGG + Intergenic
1149339445 17:55670666-55670688 GCCCACCTAGACCAAGGTTCTGG + Intergenic
1151703918 17:75757019-75757041 GCCCTACAAGTTCAAGGTGCAGG + Exonic
1152102768 17:78312492-78312514 GAAGTCCAAGATCATGGTGCTGG - Intergenic
1152374795 17:79913524-79913546 GCCCCCCAAGATCAGAGTGCAGG + Intergenic
1154031720 18:10758972-10758994 CTCCTCCAAGACCAGAGTGCTGG - Intronic
1154305844 18:13230212-13230234 GACGTCCAAGATCAAGGTGCCGG - Intronic
1158984946 18:62804460-62804482 GGCCTCCCAGCCCAAGGTGCTGG - Intronic
1160213042 18:76899897-76899919 GAAGTCCAAGATCATGGTGCTGG + Intronic
1162907045 19:13830344-13830366 GCACTGCAAGGCCAGGGTGCGGG - Exonic
1164841635 19:31397474-31397496 GCTCTCCTTGTCCATGGTGCTGG + Intergenic
1164864325 19:31591273-31591295 GAAGTCCAAGACCAAGGTGCTGG - Intergenic
1165797292 19:38526511-38526533 GCCCTCAAGGACCAAGGTGAGGG - Intronic
1167266957 19:48487979-48488001 GGCTCCCAAGACCATGGTGTGGG - Intronic
925086947 2:1115948-1115970 GCCCTCCAGGACCTTGGCGGAGG + Intronic
925712290 2:6753081-6753103 GAAGTCCAAGATCATGGTGCTGG - Intergenic
927084180 2:19658141-19658163 GAATTCCAAGAACATGGTGCTGG + Intergenic
927104599 2:19812399-19812421 GCCCTCCAAGAGCCTGGAGGGGG - Intergenic
928123209 2:28598817-28598839 ACCCTTTAAGACCATGGGGCTGG + Intronic
928245901 2:29626724-29626746 GAACTCCAAGATCAAGGTGCTGG - Intronic
929532842 2:42763321-42763343 GCCCGCCCAGACCACGGTTCCGG + Exonic
929996445 2:46829070-46829092 GAAGTCCAAGATCATGGTGCTGG - Intronic
931241922 2:60461541-60461563 GCCCACCAAGTCGCTGGTGCCGG + Exonic
932496389 2:72147820-72147842 GCCCTCAAAGAGCATGTTGGCGG + Exonic
933627818 2:84621582-84621604 ACCCACCAAGACCATCTTGCAGG - Intronic
935024463 2:99263011-99263033 GAAATCCAAGAGCATGGTGCTGG + Intronic
935272538 2:101447427-101447449 GAAGTCCAAGATCATGGTGCGGG + Intronic
937985432 2:127636144-127636166 GCCCTCCAAAGCCCTGGTGGGGG - Intronic
940182206 2:150947276-150947298 GGCGTCCAAGATCAAGGTGCTGG + Intergenic
940260623 2:151776086-151776108 GAAGTCCAAGACCAAGGTGCTGG - Intergenic
940682754 2:156807008-156807030 GAAGTCCAAGAGCATGGTGCTGG + Intergenic
940698941 2:157017635-157017657 GAAGTCCAAGAGCATGGTGCTGG + Intergenic
941717108 2:168776023-168776045 GAAGTCCAAGAGCATGGTGCTGG + Intergenic
942012689 2:171778693-171778715 GAAGTCCAAGAGCATGGTGCTGG + Intergenic
942222168 2:173780799-173780821 GAAGTCCAAGACCAAGGTGCTGG - Intergenic
946582101 2:221140868-221140890 ACTCTCCATGGCCATGGTGCTGG - Intergenic
947766984 2:232644162-232644184 GCCCTCCAAACCCAGGGGGCGGG - Intronic
948029689 2:234807051-234807073 GAAGTCCAAGACCTTGGTGCTGG - Intergenic
1170728368 20:18949480-18949502 GCCGTCCAAGATCAAGGTGTGGG + Intergenic
1171508344 20:25658166-25658188 TCCCTCCTACAGCATGGTGCTGG + Intergenic
1172949030 20:38710494-38710516 GTCCTCCCAGCCCATTGTGCTGG - Intergenic
1175053393 20:56175679-56175701 GACATCCAAGATCAAGGTGCTGG - Intergenic
1175780142 20:61676946-61676968 GCGGTCCAAGACCTTGGGGCAGG + Intronic
1176043419 20:63080144-63080166 GCCTACCAACACCTTGGTGCTGG + Intergenic
1177243960 21:18498173-18498195 GAAGTCCAAGACCAAGGTGCTGG + Intergenic
1177815961 21:25976976-25976998 GAAGTCCAAGAACATGGTGCTGG - Intronic
1178544647 21:33482545-33482567 GAACTCCAAGAGCATGGTGCTGG + Intergenic
1178700137 21:34826363-34826385 GAAGTCCAAGAGCATGGTGCTGG - Intronic
1182108935 22:27709180-27709202 GAAGTCCAAGAGCATGGTGCTGG - Intergenic
1182997546 22:34828064-34828086 GACCTCCAACATCAAGGTGCTGG + Intergenic
1184787979 22:46680953-46680975 GCCAGCCAAGTCCTTGGTGCTGG + Intergenic
1184948440 22:47821337-47821359 GAAGTCCAAGAGCATGGTGCTGG + Intergenic
1185095749 22:48805092-48805114 GGCCTCCTGGACCACGGTGCTGG + Intronic
1185254553 22:49825128-49825150 CCCCACTGAGACCATGGTGCTGG + Intronic
949525198 3:4896518-4896540 CCTGTCCAAGACCAAGGTGCTGG + Intergenic
951515275 3:23552071-23552093 GAACTCAAAGATCATGGTGCTGG - Intronic
954571495 3:51644750-51644772 TCCCTCCAAGGCCAGGATGCGGG + Intronic
955520500 3:59771047-59771069 GCCCTCCAAAACTAGAGTGCAGG - Intronic
956267408 3:67412607-67412629 GCCACCCAAGACAATCGTGCTGG - Intronic
957853837 3:85847058-85847080 TCCCTTGAAGCCCATGGTGCTGG - Intronic
958781118 3:98543486-98543508 GAAATCCAAGAGCATGGTGCTGG - Intronic
961524833 3:127490156-127490178 GGAGTCCAAGACCATGGTGCTGG - Intergenic
964881757 3:161431177-161431199 GAAGTCCAAGACCACGGTGCTGG + Intergenic
965272623 3:166638390-166638412 CCACTCCAAGTCCATGGAGCAGG + Intergenic
966263092 3:178003289-178003311 GATGTCCAAGACCAAGGTGCTGG - Intergenic
968894074 4:3388608-3388630 ACTCTCCAGGACCATGGGGCTGG - Intronic
969637800 4:8379405-8379427 TCCCTCCAAGGCCTTGGGGCTGG + Intronic
970277399 4:14416476-14416498 GCCTTCCAAAACCAGGGTGGAGG + Intergenic
970375706 4:15455173-15455195 GCCCTCCAGGGCCTTGGTGGAGG + Intergenic
973536249 4:51885283-51885305 GCCTTGAAAGAGCATGGTGCAGG + Intronic
976678373 4:87727894-87727916 GAAGTCCAAGAGCATGGTGCTGG + Intergenic
977807377 4:101317212-101317234 GGCCTCCAAGACCATGTTGAAGG - Intronic
977812585 4:101374281-101374303 CCAGTCCAAGACCATGGTGGTGG + Intergenic
977873857 4:102125913-102125935 GAAGTCCAAGAGCATGGTGCTGG - Intergenic
978240276 4:106507222-106507244 GAAGTCCAAGAGCATGGTGCTGG + Intergenic
979714590 4:123822512-123822534 GAAGTCCAAGACCAAGGTGCTGG + Intergenic
979784410 4:124697631-124697653 GAAATCCAAGAGCATGGTGCTGG - Intronic
981740568 4:147996924-147996946 CAAGTCCAAGACCATGGTGCTGG - Intronic
983941557 4:173538522-173538544 CACCTCCCAGACCCTGGTGCCGG + Intergenic
985000285 4:185475654-185475676 GGCCTCCCAAACCATAGTGCTGG - Intergenic
986697738 5:10373639-10373661 GCCCTCCAGGAACATCGTGACGG - Intronic
986891572 5:12314910-12314932 GCTCTCCTAAACTATGGTGCTGG + Intergenic
987713312 5:21532716-21532738 GCTGTCAAAGAGCATGGTGCTGG - Intergenic
988610682 5:32721826-32721848 GAAGTCCAAGAGCATGGTGCTGG + Intronic
990025347 5:51180848-51180870 GTCCTCCAAGATGATGGTACTGG - Intergenic
991275398 5:64841145-64841167 GAAGTCCAAGACCATGGTGCTGG + Intronic
993319154 5:86451630-86451652 GAAGTCCAAGAGCATGGTGCTGG - Intergenic
996771617 5:127092501-127092523 GAAGTCCAAGACCAGGGTGCCGG - Intergenic
998656202 5:144182273-144182295 GAAGTCCAAGAGCATGGTGCTGG - Intronic
999736836 5:154519216-154519238 GACCTCCAAGACCATGTTTAAGG - Intergenic
999808368 5:155105071-155105093 TCCCTCCCAGAGCAGGGTGCTGG + Intergenic
1000694189 5:164359471-164359493 GAAGTCCAAGAGCATGGTGCTGG - Intergenic
1002488847 5:179559638-179559660 GCCCTCTAAGAGCTTGGGGCAGG + Intronic
1002653202 5:180719350-180719372 GAGCTCCAAGACCAAGGTGTGGG - Intergenic
1005447759 6:25942140-25942162 GCTCTCCAAGCTCATGGTCCTGG + Intergenic
1005471307 6:26164818-26164840 ACCCTACAAGATCAAGGTGCCGG - Intronic
1006258883 6:32852588-32852610 GCCCTCCAGGATAATGGTGAGGG - Intronic
1007298594 6:40848414-40848436 GACGTCCAAGATCAAGGTGCTGG + Intergenic
1010185699 6:73141134-73141156 GAAGTCCAAGATCATGGTGCTGG + Intronic
1010380310 6:75216499-75216521 GGCATCCAAGATCATGGTGCTGG + Intergenic
1013580298 6:111527390-111527412 AAAGTCCAAGACCATGGTGCTGG - Intergenic
1013692983 6:112667597-112667619 GGCCTCCCAGTCCATGGAGCAGG + Intergenic
1014640084 6:123898821-123898843 GCCCTTCCAGGCCATGGTACTGG - Intronic
1015215315 6:130743375-130743397 TCCCTCCAAACCCATGGAGCTGG + Intergenic
1016896609 6:149059939-149059961 GCCCACCAAGACCAGGGCACTGG - Intronic
1017697429 6:157031218-157031240 GCTCTCCAAAACCATGTTCCAGG - Intronic
1019422040 7:954983-955005 GCCCCCCAAGACCATGGGCATGG + Intronic
1019442151 7:1052809-1052831 GCCCCCCAACCCCATGCTGCAGG - Intronic
1022842262 7:34175970-34175992 GAAGTCCAAGATCATGGTGCTGG + Intergenic
1025951283 7:66147430-66147452 CCCTTCCAAGACTATGGGGCGGG - Intronic
1031348320 7:120696794-120696816 GAAGTCCAAGAGCATGGTGCTGG - Intronic
1031660352 7:124416552-124416574 GACGTCCAAGATCAGGGTGCCGG - Intergenic
1033483928 7:141769330-141769352 GAAGTCCAAGAGCATGGTGCTGG - Intronic
1034956570 7:155338861-155338883 TCTCACCAAGACCTTGGTGCTGG + Intergenic
1034987268 7:155524043-155524065 GCCTGCCAACACCATGGTCCTGG + Intronic
1037772004 8:21807370-21807392 GCAATACAAGAGCATGGTGCTGG - Intronic
1038213903 8:25544133-25544155 GAAGTCCAAGAGCATGGTGCTGG + Intergenic
1039273565 8:35909729-35909751 GCAGTCCAAGATCAAGGTGCTGG + Intergenic
1040061019 8:43102799-43102821 GCCGTGCAAGGCCATGGTGGAGG - Intronic
1040614401 8:49020006-49020028 GAAGTCCAAGACCAAGGTGCTGG + Intergenic
1040957721 8:52996592-52996614 GGCATCCAAGATCAAGGTGCTGG + Intergenic
1041716922 8:60940938-60940960 GACGTCCAAGACCAAGGTGCTGG + Intergenic
1042400336 8:68338101-68338123 GAAGTCCAAGATCATGGTGCTGG + Intronic
1043360837 8:79470102-79470124 GTGGTCCAAGAACATGGTGCTGG - Intergenic
1043371890 8:79604428-79604450 GAACTCCAAGATCAAGGTGCTGG + Intergenic
1044463335 8:92473903-92473925 GCCCACCAAGTCCATGATCCTGG + Intergenic
1045917385 8:107488383-107488405 GCCCTCCAAGAGCATTCCGCAGG - Intronic
1049599512 8:143500602-143500624 GAGATCCAAGAGCATGGTGCCGG + Intronic
1049806775 8:144544625-144544647 GCTCTCCAAGACGATGCTTCAGG - Intronic
1050202244 9:3157538-3157560 GCGCTCCAAGACATTGGTCCGGG - Intergenic
1055752879 9:79526919-79526941 GAAGTCCAAGAGCATGGTGCTGG - Intergenic
1057880155 9:98787103-98787125 GACCTCCAAGGCCTTGGTGGGGG + Intronic
1058395567 9:104549637-104549659 GAAGTCCAAGAGCATGGTGCTGG - Intergenic
1060985891 9:127818736-127818758 GGCCTCCAACACCATCGAGCCGG - Exonic
1062101070 9:134728841-134728863 GCCCCTCGAGGCCATGGTGCAGG + Intronic
1062111656 9:134785314-134785336 GCCTTCCAAGGCGATGGTGGAGG - Intronic
1188651519 X:32636296-32636318 GACCTCCAAGATCAGGTTGCAGG - Intronic
1190212792 X:48461064-48461086 GCCCTCCAAGCGCAGGATGCAGG - Exonic
1191756062 X:64593877-64593899 TAACTCCCAGACCATGGTGCTGG + Intergenic
1193497266 X:82230509-82230531 GCCTGCCAAGGCCATGGTACAGG - Intergenic