ID: 1147421864

View in Genome Browser
Species Human (GRCh38)
Location 17:40325955-40325977
Sequence TTGGATTTAGGGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 654
Summary {0: 1, 1: 0, 2: 7, 3: 38, 4: 608}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147421864_1147421880 28 Left 1147421864 17:40325955-40325977 CCTTCTCCCCTCCCTAAATCCAA 0: 1
1: 0
2: 7
3: 38
4: 608
Right 1147421880 17:40326006-40326028 AAAGAAGGGAATTTGGGAATGGG 0: 1
1: 1
2: 2
3: 58
4: 565
1147421864_1147421878 22 Left 1147421864 17:40325955-40325977 CCTTCTCCCCTCCCTAAATCCAA 0: 1
1: 0
2: 7
3: 38
4: 608
Right 1147421878 17:40326000-40326022 GAAATGAAAGAAGGGAATTTGGG 0: 1
1: 0
2: 2
3: 82
4: 892
1147421864_1147421877 21 Left 1147421864 17:40325955-40325977 CCTTCTCCCCTCCCTAAATCCAA 0: 1
1: 0
2: 7
3: 38
4: 608
Right 1147421877 17:40325999-40326021 TGAAATGAAAGAAGGGAATTTGG 0: 1
1: 0
2: 2
3: 61
4: 742
1147421864_1147421875 13 Left 1147421864 17:40325955-40325977 CCTTCTCCCCTCCCTAAATCCAA 0: 1
1: 0
2: 7
3: 38
4: 608
Right 1147421875 17:40325991-40326013 TTGGTTTGTGAAATGAAAGAAGG 0: 1
1: 0
2: 3
3: 27
4: 425
1147421864_1147421879 27 Left 1147421864 17:40325955-40325977 CCTTCTCCCCTCCCTAAATCCAA 0: 1
1: 0
2: 7
3: 38
4: 608
Right 1147421879 17:40326005-40326027 GAAAGAAGGGAATTTGGGAATGG 0: 1
1: 1
2: 2
3: 76
4: 784
1147421864_1147421871 -6 Left 1147421864 17:40325955-40325977 CCTTCTCCCCTCCCTAAATCCAA 0: 1
1: 0
2: 7
3: 38
4: 608
Right 1147421871 17:40325972-40325994 ATCCAAAGGTTTCCCTTTTTTGG 0: 1
1: 0
2: 0
3: 17
4: 220
1147421864_1147421876 14 Left 1147421864 17:40325955-40325977 CCTTCTCCCCTCCCTAAATCCAA 0: 1
1: 0
2: 7
3: 38
4: 608
Right 1147421876 17:40325992-40326014 TGGTTTGTGAAATGAAAGAAGGG 0: 1
1: 0
2: 5
3: 54
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147421864 Original CRISPR TTGGATTTAGGGAGGGGAGA AGG (reversed) Intronic
902624485 1:17668618-17668640 TTGGCTGGAGGGAGGCGAGATGG + Intronic
902798385 1:18814515-18814537 TTGGGGTTAGGGAGGGGAGTAGG - Intergenic
902824288 1:18962357-18962379 TTGTTTTTTGGGAGGAGAGATGG - Intergenic
902951950 1:19891596-19891618 TTGGAGGTGAGGAGGGGAGAGGG + Intronic
903014510 1:20353326-20353348 ATGGATTGGGGGTGGGGAGAGGG + Intronic
903390001 1:22956930-22956952 TTGCCTCTAGGGAGGGGAAATGG - Intronic
903670135 1:25030684-25030706 TGAAATTTAGGGAGGGGAGGAGG + Intergenic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904036996 1:27564275-27564297 TTGGCTTCGGGGAGGGGGGAAGG + Intronic
904584386 1:31571823-31571845 GTGGATTTAGAGAGGTCAGATGG - Intergenic
904889917 1:33772073-33772095 TTGGATTTAGGGAGGGAAAAGGG - Intronic
904890060 1:33773029-33773051 TTGGATTTAGGGAGGGGTAAGGG - Intronic
905478430 1:38245045-38245067 TGGGAGTGAGGGAGGGGAGTGGG + Intergenic
905811429 1:40916249-40916271 TTGGGTTTGGTGAGGGCAGATGG - Intergenic
907435443 1:54443096-54443118 TGGGGTGTAGGGAGGGGGGAGGG - Intergenic
907677978 1:56536419-56536441 TTGAATTTGGGGAGGGGGAAGGG - Intronic
908427154 1:64018226-64018248 TTGGCTAAAGGGAGGGGAAACGG + Intronic
909037452 1:70610187-70610209 TGGGATTGGGGGAGGGGGGAGGG - Intergenic
909261728 1:73498686-73498708 CTGATTTTAGGGAGGGGAGGCGG - Intergenic
909369984 1:74872450-74872472 TGGGTTTGAGGGAGGGGGGAAGG - Intergenic
909925297 1:81431202-81431224 TTGGAGGTAGGGTGGGGAGTTGG + Intronic
910869497 1:91819736-91819758 GTGGATTTAGGGGAGGGAGGGGG - Intronic
910903813 1:92151701-92151723 GGGGATTTAGGGAGGGGAGAAGG - Intergenic
911176543 1:94823194-94823216 TTGGATTTAGAGGGAGGAAAGGG - Intronic
911526548 1:98994239-98994261 ATGGAAGGAGGGAGGGGAGAGGG + Intronic
911528688 1:99017193-99017215 TTAGATTTAGGTAGTGGACATGG - Intergenic
911881960 1:103251233-103251255 TTGGGTGGAGGGAGGGGGGAGGG + Intergenic
912232793 1:107815310-107815332 TGGGAGTTAGTGAGGGGAAAGGG + Intronic
912765242 1:112403034-112403056 TTTCATTTAGGGAGGTAAGAGGG - Intronic
913654505 1:120948239-120948261 TAGGCTTTTGGGAGGGGAGATGG - Intergenic
914226718 1:145725935-145725957 TAGAATTAAGGGAGGGGAGCTGG + Intronic
914520195 1:148408377-148408399 TAGGCTTTTGGGAGGGGAGATGG - Intergenic
914594403 1:149135967-149135989 TTGGGTAGGGGGAGGGGAGAGGG - Intergenic
914644701 1:149642401-149642423 TAGGCTTTTGGGAGGGGATATGG - Intergenic
914823785 1:151126148-151126170 TTGCTTTTAGGGAAGGGAGTGGG - Intergenic
915086008 1:153389422-153389444 TGGGAGTTTGGGAGTGGAGAGGG + Intergenic
915213286 1:154325468-154325490 GGGGTTTTGGGGAGGGGAGAAGG - Intergenic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915473685 1:156140043-156140065 ATTGATTTGGGGAGGAGAGAAGG - Exonic
915492895 1:156261252-156261274 TGGGTTATGGGGAGGGGAGATGG + Intronic
915718111 1:157963395-157963417 TTGGATTTAGGAGGGAGAGGTGG + Intergenic
915907357 1:159888512-159888534 ACAGAGTTAGGGAGGGGAGAGGG + Intronic
916489103 1:165285831-165285853 ATGGATTTAGGGAGGAAGGACGG + Intronic
916959818 1:169877702-169877724 CTGGATTCAAGGATGGGAGAGGG + Intronic
917697894 1:177546850-177546872 ATGGATTTTGTGAGGGAAGATGG - Intergenic
917745489 1:178002856-178002878 TTGGGTTTTGGCAGTGGAGATGG - Intergenic
918110440 1:181450949-181450971 TAGGATTGAGGGAGAGGAGGTGG + Intronic
918809274 1:189094381-189094403 GTGGAGTTTGGCAGGGGAGACGG + Intergenic
918944147 1:191039652-191039674 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
919067137 1:192706671-192706693 GTGGATTTGGGGAGGAGAGGAGG + Intergenic
919791794 1:201296038-201296060 TGGGTCTTAGGGTGGGGAGAAGG - Intronic
919933636 1:202237222-202237244 CTGGATGGAGGGAGAGGAGAGGG - Intronic
919935230 1:202246361-202246383 ATGGATGGAGGGAGGGGGGATGG - Intronic
921565703 1:216715548-216715570 TTGGAATTATGGAGGGCAAAGGG + Intronic
922022179 1:221716413-221716435 TAGGATTAAGGGAGAGCAGAAGG - Intronic
922086726 1:222355748-222355770 TTGGGTTGGGGGAGGGGGGAGGG + Intergenic
922131691 1:222786700-222786722 TAGGTTTTAAGGAGGGGATAAGG - Intergenic
922317696 1:224457038-224457060 CTGGATGTGGCGAGGGGAGACGG + Intronic
923148180 1:231212094-231212116 TTAGGTTTAGGAAGGGGAGGGGG + Intronic
1063198362 10:3763897-3763919 TTTGATTTGGGGAGGGATGATGG + Intergenic
1063763288 10:9106818-9106840 AGGGATGTAGGGAAGGGAGAAGG + Intergenic
1064998884 10:21319430-21319452 GGGGATTGAGGGATGGGAGAAGG - Intergenic
1066449053 10:35511465-35511487 GTGGAGTCAGGGAGGGGAAAAGG + Intronic
1066649773 10:37643260-37643282 TTCCACTTAAGGAGGGGAGAGGG - Intergenic
1066802779 10:39208739-39208761 TTTGGTTTAGAGAGGGGAGGGGG + Intergenic
1066803457 10:39216527-39216549 TGGGATGTGGGGAGGGGGGAGGG + Intergenic
1066826792 10:39602619-39602641 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1067750313 10:48967385-48967407 TGTGATTTAGGGAGGGAAGAGGG + Intronic
1067750775 10:48969732-48969754 TGGGATTAGGGGAGGGGAGCTGG - Intronic
1068300736 10:55135431-55135453 TTGTGTTTAGGGAGTGGAGCTGG - Intronic
1068941605 10:62686442-62686464 TGGGATTTTGGGAGAGGAGATGG + Intergenic
1069002755 10:63284028-63284050 TTGTTTTTTGGGAGGGGGGACGG + Intronic
1069877370 10:71571400-71571422 TGGGCATTAGGGAGGGCAGAAGG - Intronic
1069948427 10:72002918-72002940 TTGCATTCTGGGAAGGGAGATGG + Intronic
1070156748 10:73840037-73840059 TGGGATGTAGAGAGGGGAGAGGG - Intronic
1070651408 10:78239789-78239811 ATTGATTTGGGGAGGAGAGAAGG + Intergenic
1070941406 10:80351462-80351484 GTGGACTTAGGCAGGGGAGGTGG - Intronic
1071060136 10:81560532-81560554 TGGGGTTTGGGGAGGGGGGAGGG - Intergenic
1071587744 10:86841784-86841806 CAACATTTAGGGAGGGGAGAAGG + Intronic
1071806973 10:89133223-89133245 TTGATTTAAGGGAGGGGGGAGGG - Intergenic
1072081162 10:92033539-92033561 TTTGGTTTAGAGAGGGGAGGGGG - Intergenic
1072282276 10:93877680-93877702 TTGTATTTTGGGGGGAGAGATGG - Intergenic
1073047122 10:100646121-100646143 TGGGACTGAGGGAGGGGAGGAGG + Intergenic
1073153951 10:101331674-101331696 TTGGGGTGAGGGAGGGGGGAAGG + Intergenic
1073333368 10:102686002-102686024 CTGGATTTTGAGAAGGGAGAGGG + Intronic
1073997036 10:109327386-109327408 TTGTATTTAGGGAGAGGAGGAGG - Intergenic
1074186246 10:111101723-111101745 TGGGATTTTGGGTGGGCAGAAGG - Intergenic
1074554300 10:114474327-114474349 TTTGAAGAAGGGAGGGGAGAAGG - Intronic
1074628182 10:115218011-115218033 ATGGACCCAGGGAGGGGAGATGG + Intronic
1075670492 10:124260996-124261018 TTGGAGTGAAGGAGGGGAGGAGG - Intergenic
1075814306 10:125253167-125253189 TTGGATAAAGGGAGGGGAAAGGG - Intergenic
1075814324 10:125253243-125253265 TTGGATGAAGGGAGGGAGGAAGG - Intergenic
1076438819 10:130465233-130465255 TTGGAGTTAGGAGGGGCAGAAGG - Intergenic
1076885530 10:133260757-133260779 GTGCATTTGGGGATGGGAGAAGG + Intergenic
1077194737 11:1273673-1273695 TGGGATTTGGGCAGGGGAGGCGG + Intergenic
1077801410 11:5542270-5542292 GTGGATCCAGGGAGGGGATAGGG - Intronic
1078182299 11:9022235-9022257 TTTGATTTGGGGAGAGAAGATGG - Intronic
1078444787 11:11395974-11395996 GTGGAGATGGGGAGGGGAGAGGG + Intronic
1079266599 11:18939051-18939073 TTGGAATAAGGGAGGTGATATGG + Intronic
1079319366 11:19438988-19439010 CTGGAATTGGGGAGTGGAGAGGG + Intronic
1079611061 11:22432861-22432883 TTTGATGTTGGGAGGGGAAATGG + Intergenic
1081775460 11:45673428-45673450 TTGGGTTTGAGGAAGGGAGATGG - Intergenic
1082311475 11:50654458-50654480 TGGGATTGGGGGAGGGGGGAGGG + Intergenic
1082598203 11:55111714-55111736 TGGGATTGGGGGAGGGGGGAGGG + Intergenic
1082628642 11:55515371-55515393 TGGGGTTGAGGGAGGGGGGAGGG - Intergenic
1083112009 11:60419991-60420013 TTGCATCTAGGTAGGTGAGATGG + Intergenic
1083143187 11:60738374-60738396 TTGAATTGAGGGAAGGGAGTCGG - Intronic
1083285454 11:61655978-61656000 GTGGAGTTGGGCAGGGGAGAAGG - Intergenic
1083497103 11:63065446-63065468 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1083518313 11:63282351-63282373 TGGGATTGTGGGAGGGGAGAGGG - Intronic
1083731198 11:64653617-64653639 TGGGATTTAGGGAGGGAGGCTGG - Intronic
1084194770 11:67518219-67518241 ATGGAGTTAGGGAGGGAGGAAGG + Intergenic
1084365504 11:68694993-68695015 TTGAATTAAGGGAAGGTAGATGG - Intergenic
1085046496 11:73356641-73356663 TGGGATTTTTGGAGGGGATAGGG + Intronic
1085467339 11:76733163-76733185 GTGGATGTAGGGATGGCAGATGG + Intergenic
1086096692 11:83057566-83057588 TTGGGTTGAGGGAGAGGAAAGGG + Intronic
1087002749 11:93437084-93437106 TTGGAGTTAGCCAGGTGAGAGGG - Intronic
1087736825 11:101843301-101843323 TGGGGTTGCGGGAGGGGAGAGGG + Intronic
1088026535 11:105191119-105191141 TTGTATTTAGGTAGGGTACAAGG - Intergenic
1088390857 11:109313734-109313756 TGGGGTTGAGGGAGGGGGGAGGG - Intergenic
1088490506 11:110382923-110382945 TGGGGTTTGGGGAGGGGGGAGGG - Intergenic
1089217132 11:116841191-116841213 TGAGAGTTAGGGAGGGGAGGTGG + Intergenic
1089804455 11:121070703-121070725 TGGGATTCGGGGAGGGGGGAGGG + Intronic
1090200970 11:124855933-124855955 TTGAATTTAGGGAGTTGAGGAGG - Intergenic
1091575765 12:1733748-1733770 TGGGGTTGAGGGAGGGGGGAGGG - Intronic
1091641062 12:2237888-2237910 GTGGAGCTAGGGAGGGCAGAGGG - Intronic
1092910488 12:13140968-13140990 TTGGATGTAGGGCGGGATGAGGG - Intronic
1093017203 12:14166639-14166661 TGGGATAAAGGGAGGGGATAAGG - Intergenic
1093769723 12:23004358-23004380 TGGGATTTAGGTGTGGGAGAAGG + Intergenic
1095814398 12:46405841-46405863 TTAGATGTGGGGAGGTGAGATGG + Intergenic
1096036210 12:48473465-48473487 TTGGAGTGGGGGAGGGGATACGG - Exonic
1097161980 12:57053153-57053175 TGGGATGTGGGGAGGGGGGAGGG - Intergenic
1098362036 12:69664369-69664391 TTGGATACAGTAAGGGGAGAGGG - Intronic
1098562095 12:71886117-71886139 TTGGATATATGGAGGTAAGAAGG + Intronic
1098830530 12:75355975-75355997 TTGGGGGTAGGGTGGGGAGAGGG + Intronic
1100476623 12:94941135-94941157 CTGGAATTAGGGATGGAAGAAGG - Intronic
1101042448 12:100770626-100770648 TTGCATTGAAGGAGGTGAGAAGG + Intronic
1101215714 12:102579885-102579907 TGGGATGTGGGGAGGGGGGAGGG + Intergenic
1101551902 12:105771101-105771123 ATGAATTTGGGGTGGGGAGAGGG + Intergenic
1101909394 12:108850460-108850482 GAGGATCTAGGGAGGGGAGCTGG + Intronic
1101909439 12:108850582-108850604 GGGGATTTAGGGAGGGGAGCTGG + Intronic
1101909474 12:108850678-108850700 TGGGATCTAGGGAGGGGATTTGG + Intronic
1102402139 12:112638969-112638991 TTGGTTTTAGGGAGATCAGATGG + Intronic
1103290216 12:119839478-119839500 TTGGCATGAGGGAGGAGAGAAGG + Intronic
1104707460 12:130958173-130958195 TAGGATGGAGGGAGGGGGGAGGG - Intronic
1105347750 13:19589490-19589512 TAGGAGTTAGGCAGGGCAGAAGG - Intergenic
1105983614 13:25544491-25544513 TTGGAGACAGGGAGGAGAGATGG + Intronic
1105993163 13:25643063-25643085 TGGGATGGGGGGAGGGGAGAGGG + Intronic
1106445200 13:29823848-29823870 TTGGATGGGGGGAGGGGGGAGGG - Intronic
1107530434 13:41277747-41277769 TAACATTCAGGGAGGGGAGAGGG - Intergenic
1108527381 13:51297355-51297377 CTGGAATTAGGGAGGGATGAAGG + Intergenic
1108611750 13:52090703-52090725 TAGGATTTGGGGGGTGGAGAGGG - Intronic
1109691367 13:65895028-65895050 GAGGGGTTAGGGAGGGGAGAGGG + Intergenic
1109710080 13:66147624-66147646 TTGGATTTAGTGAATGCAGAAGG - Intergenic
1109947859 13:69462142-69462164 TTTGGTTTAGAAAGGGGAGAGGG + Intergenic
1110044343 13:70810030-70810052 TTTGGTTTAGAGAGGGGAGGGGG + Intergenic
1110425034 13:75357473-75357495 CTGGAGTTGGGGAGGTGAGAAGG - Intronic
1110772243 13:79363028-79363050 TTGGATATAGGGAGGAGGAAGGG - Intronic
1110878377 13:80539357-80539379 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1110992832 13:82065892-82065914 TTAGATTTATGGAGGAGAGAAGG + Intergenic
1111365397 13:87236505-87236527 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1111375655 13:87376670-87376692 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1112295285 13:98180753-98180775 TGGGATTTTGGGAGGGAATAGGG + Intronic
1112630600 13:101157726-101157748 TTTGAGCTAGGGAGGGGACATGG + Intronic
1112784048 13:102932104-102932126 TTATATTTAGGGAGGGGTAATGG + Intergenic
1112843330 13:103606778-103606800 TTGGATGTGGGGAGAGGGGAGGG - Intergenic
1114500862 14:23167307-23167329 TGGAATTCAGGGAGAGGAGAGGG + Intronic
1114517522 14:23309327-23309349 TGGGATTTAGGGAACGCAGAAGG + Exonic
1114693452 14:24606352-24606374 TGGGGTTTAGGGAGGAGGGAGGG + Intergenic
1114887849 14:26877048-26877070 ATGTATTTATGGAGGGGAAAAGG - Intergenic
1114914162 14:27240973-27240995 TTGGGTTGCGGGAGGGGTGAGGG + Intergenic
1115270972 14:31551960-31551982 ATGGAATTAGGAAGGGTAGAGGG + Intronic
1115286001 14:31712969-31712991 TAGGAATTAGGGAGGGGTAAGGG + Intronic
1115867723 14:37766942-37766964 TGGGATGTGGGGAGGGGAGAGGG - Intronic
1116673113 14:47869474-47869496 TGGGATGGAGGGAGGAGAGAGGG - Intergenic
1116729612 14:48605383-48605405 TTTGTTTTTGGGAGGTGAGATGG - Intergenic
1117240625 14:53829050-53829072 GTGGAATTAGGGAGGGGTCATGG + Intergenic
1117753651 14:58950696-58950718 TGGCATTTAGGAAGGGGAGGAGG - Intergenic
1117857707 14:60052198-60052220 TTACATTCAGGGAGGGAAGAAGG + Intronic
1118098014 14:62561158-62561180 TTGGGTGGAGGGAGGGGGGAGGG + Intergenic
1118482370 14:66180155-66180177 TTGGATATGGGGAGGAGTGAGGG - Intergenic
1118926784 14:70198441-70198463 TGGGTTTGAGGGAGGGGGGAGGG - Intergenic
1122467136 14:101941570-101941592 TGGGATGGGGGGAGGGGAGAGGG - Intergenic
1123152578 14:106197128-106197150 CTAGGTTTAGGAAGGGGAGAGGG + Intergenic
1123175160 14:106409967-106409989 TTGGCTTTAGGGTCAGGAGAAGG + Intergenic
1123187720 14:106536476-106536498 TTTGGTTTAGAGAGGGGAGGGGG + Intergenic
1123201939 14:106674491-106674513 TTGGCTTTAGGGTCAGGAGAAGG + Intergenic
1202943526 14_KI270726v1_random:5811-5833 TTGGCTTTAGGGTCAGGAGAAGG - Intergenic
1202943763 14_KI270726v1_random:8057-8079 TGGGCTGTGGGGAGGGGAGAGGG - Intergenic
1124171907 15:27381828-27381850 TTGGATGTGGGGATGAGAGATGG + Intronic
1125832979 15:42729398-42729420 TGATACTTAGGGAGGGGAGAGGG - Intronic
1127465008 15:59235299-59235321 TTGTCTTGAGGGAGGGGAGCTGG - Intronic
1127576038 15:60293354-60293376 TTGGAGTGAGGGAGGAGACAGGG + Intergenic
1128914905 15:71550836-71550858 TTGGAATTAGGTAGTGGTGATGG + Intronic
1129273660 15:74432449-74432471 TCTGGGTTAGGGAGGGGAGAAGG - Intronic
1129425007 15:75456139-75456161 TTGGAACTAGGTAGGAGAGAAGG + Intergenic
1129946623 15:79543946-79543968 TTGGTTTTAGTGAGGGAGGATGG - Intergenic
1130138528 15:81202467-81202489 GTGGGTGTAGGGAGGGGGGAGGG - Intronic
1130200773 15:81824541-81824563 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1130410127 15:83640092-83640114 GTGGCTTCAGGGAGGTGAGAAGG + Intergenic
1131065612 15:89433393-89433415 TTGGAGGGAGGGAGGGAAGAAGG - Intergenic
1131285516 15:91053781-91053803 CTGGGGTTAGGGAGGGGTGAAGG - Intergenic
1131537539 15:93250026-93250048 TTGAATCTGGGGAGGGGAAAGGG + Intergenic
1132394055 15:101459465-101459487 GTGGACTTAGGGTGGGGGGACGG - Intronic
1132394070 15:101459508-101459530 GTGGACTTAGGGTGGGGGGACGG - Intronic
1132460044 16:48331-48353 TGGGACTCAGGGAGGGGAGGGGG - Intronic
1133335693 16:5005387-5005409 CTGGGTTGGGGGAGGGGAGATGG + Intronic
1133597003 16:7303289-7303311 TTGGGCTGAGGGAGGGGAGGAGG - Intronic
1133804702 16:9115962-9115984 ATGGAAGTGGGGAGGGGAGAGGG - Intronic
1135015788 16:18924169-18924191 TTGGCTCTGGGGAGGGGCGATGG - Intronic
1135321404 16:21499982-21500004 TTGGCTCTGGGGAGGGGCGATGG - Intergenic
1135374237 16:21931477-21931499 TTGGCTCTGGGGAGGGGCGATGG - Intergenic
1135437549 16:22439237-22439259 TTGGCTCTGGGGAGGGGCGATGG + Intergenic
1136469187 16:30467392-30467414 TGGGATTTAGGGATGGGCGGTGG + Intergenic
1136899962 16:34024538-34024560 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1137070050 16:35897141-35897163 TTTGGTTTAGAGAGGGGAAAGGG + Intergenic
1137525666 16:49234076-49234098 TGGGGTGTGGGGAGGGGAGAGGG + Intergenic
1137568812 16:49551374-49551396 GTGTATTTTGGGAGGGGGGATGG - Intronic
1137788619 16:51155696-51155718 TTGGAGTTAGGGTTGGGGGAGGG + Intergenic
1138037323 16:53622451-53622473 TAGGATTGGGGGAGAGGAGAGGG - Intronic
1138443650 16:57050005-57050027 TTGAATTCAGGGAGGGGGGATGG - Intronic
1138544438 16:57707297-57707319 TTGGGTGATGGGAGGGGAGATGG + Intronic
1138646814 16:58431652-58431674 TTGGAGTGAGGGAGGAAAGATGG - Intergenic
1138701949 16:58873280-58873302 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1138714053 16:59001628-59001650 TGGGATGGAGGGAGGGGGGAGGG - Intergenic
1139038758 16:62979157-62979179 TTGTGTTTAGGGAGTGGAGTAGG - Intergenic
1139354325 16:66358328-66358350 TTGGATGTGGGGAGGGGAGCTGG + Intergenic
1140338552 16:74135104-74135126 TGGGATTCAGGGAGGAGGGAGGG + Intergenic
1140642127 16:76987332-76987354 TTGGATTTCAGGAAAGGAGATGG - Intergenic
1140767072 16:78169801-78169823 GTGGATTGAGAGAGAGGAGAGGG + Intronic
1140825209 16:78699969-78699991 TTGGTCTTGGGGAGGGGAGGTGG + Intronic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141830371 16:86506968-86506990 TTGGACGTAGAGAGGGGAGATGG + Intergenic
1142614112 17:1125138-1125160 CTGGGTTTGGGGAGGGGTGACGG - Intronic
1142856730 17:2734850-2734872 TGGGACTTGGGGAGGTGAGATGG - Intergenic
1143296722 17:5876810-5876832 GGGGATTTGGGGAGGAGAGAAGG - Intronic
1143737697 17:8924598-8924620 TTGGATTAATGGAGAGAAGACGG - Intronic
1144308601 17:13992092-13992114 ATTGATTTCTGGAGGGGAGACGG + Intergenic
1146307568 17:31742374-31742396 TTGGACAGAGGGAGGAGAGAAGG + Intergenic
1146808660 17:35885801-35885823 TTGGATATAGGGTAGGGGGACGG + Intergenic
1147421864 17:40325955-40325977 TTGGATTTAGGGAGGGGAGAAGG - Intronic
1147444468 17:40466518-40466540 CTGGCTTTTGGGAGGGGAGGTGG + Intergenic
1148018379 17:44538421-44538443 TAGGATTTATGGAAGGAAGAGGG - Intergenic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1148439370 17:47703636-47703658 TTCGGTTTAAGGAGGGAAGATGG - Intronic
1148604077 17:48915681-48915703 ATGGAGTTAGTGAGGGGAGAGGG - Intronic
1149644420 17:58229389-58229411 TTGGCTTTAGGGTGGGGAAGAGG - Intronic
1150234285 17:63580284-63580306 TTAGATTTGGGGAGGAAAGAAGG + Intronic
1150616623 17:66777423-66777445 TTTGATTTGGGGTGGGGGGAGGG - Intronic
1150815062 17:68386401-68386423 TTGGATCTAGGGAAGTCAGAGGG - Intronic
1151167806 17:72219901-72219923 ACGGCTTTGGGGAGGGGAGAGGG - Intergenic
1151183036 17:72343423-72343445 ATGGCTTTAGGGAGGGGTGCAGG + Intergenic
1151652968 17:75481398-75481420 TGAGATTTAGGGAAGGGAGCTGG + Intronic
1151732644 17:75920453-75920475 TTCTAGTTAGGGAGGGGACAGGG + Intronic
1151902176 17:77023683-77023705 TTGTATTTAGAAAGGTGAGAAGG + Intergenic
1151941955 17:77298294-77298316 ATGAACTTAGTGAGGGGAGATGG - Intronic
1152181604 17:78825609-78825631 TTGGATTTGGGGCTGTGAGATGG - Intronic
1152788015 17:82261890-82261912 ATGGTTTGAGGGAGGGAAGAGGG - Intronic
1152796559 17:82310483-82310505 GAGGATTAAGGGAGAGGAGAAGG + Intergenic
1152817035 17:82414103-82414125 TTGGAATGAGGGAGGGAGGATGG - Intronic
1153090258 18:1334952-1334974 TTGGATTTGGGGATTTGAGAAGG - Intergenic
1153190578 18:2533389-2533411 TTGGCTCTAGGGAGGGAAGAAGG + Intergenic
1153398808 18:4658490-4658512 ATGGATGTAGGGAAGAGAGATGG - Intergenic
1153515447 18:5896368-5896390 TTGGAATCAGAGAGGGGAGGTGG + Intergenic
1153637206 18:7122873-7122895 TTCGCTTTAGGCAGGGGTGAGGG + Intergenic
1154428624 18:14291380-14291402 TTTGGTTTAGAGAGGGGAGGGGG + Intergenic
1154467180 18:14658216-14658238 TTTGGTTTAGAAAGGGGAGAGGG + Intergenic
1155490424 18:26395972-26395994 GTGAATCTAGGGAGGGGAGCAGG - Intergenic
1155667617 18:28330364-28330386 AGGGATTGAGGGAGGGGAGAGGG - Intergenic
1156714449 18:39990136-39990158 TTGGGTCTAGGGGGTGGAGAGGG + Intergenic
1157008609 18:43618249-43618271 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1158121702 18:54055734-54055756 TTGGTTAAAGGGTGGGGAGATGG + Intergenic
1158165088 18:54531243-54531265 TTTGGTTTAGGTAGGGGAGGGGG + Intergenic
1158977576 18:62726186-62726208 TTGTATTTATGGATGGGAGGGGG + Intronic
1159075277 18:63674226-63674248 TTGAATTAAGGGAGTGGAGATGG - Intronic
1159117997 18:64136973-64136995 ATGGATTTGGGGAGGGGTGCAGG - Intergenic
1159701087 18:71628739-71628761 TTGGATTTCTGGAGGTCAGAAGG + Intergenic
1160176296 18:76597809-76597831 TTTAATTTTGGGAGTGGAGAAGG + Intergenic
1160682617 19:418689-418711 TTGGAGCTGGGGAGGGGACAGGG + Intronic
1161494502 19:4580167-4580189 TTGGGTTTAAGGAGGGAGGAGGG - Intergenic
1163156830 19:15444245-15444267 GTGGAGGTAGGGTGGGGAGAGGG + Intronic
1163259602 19:16180404-16180426 TTGTATTTTGGGAGGAGACAGGG + Intergenic
1163548868 19:17954058-17954080 GTGGCCTTAGGGAGGGGACATGG + Intronic
1163897047 19:20068436-20068458 TTGGGTTTACAGAGGGGAGGGGG - Intergenic
1164345513 19:27251024-27251046 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166201482 19:41240263-41240285 TTGGATATATGGAGGGTGGATGG + Intronic
1167149278 19:47699470-47699492 TTAGATTCAGGGCGGGGAGTGGG + Intronic
1167196643 19:48033601-48033623 TAGGAGTTAGCCAGGGGAGAGGG + Intronic
1167295598 19:48647162-48647184 TTGTATTTGGGGAGAAGAGATGG + Intergenic
1167752355 19:51388638-51388660 TTGGGATTAGGGAGAGGATAGGG + Exonic
1168150765 19:54446890-54446912 GTGGATTAAGGGAGGGGTGCTGG + Intergenic
1168464384 19:56589923-56589945 TTGGTTCTAGGGAGGGCACAAGG - Intergenic
1168673118 19:58256441-58256463 CTAGGTTTAGGAAGGGGAGAGGG + Intronic
1202631285 1_KI270706v1_random:2313-2335 TTTGGTTTAGAGAGGGGAGGGGG + Intergenic
925093647 2:1176023-1176045 GTGGAATTATGGAGGGGACATGG + Intronic
925526172 2:4804856-4804878 ATAGATTTGGGGAGAGGAGATGG + Intergenic
926498831 2:13627045-13627067 TGGGATGGAGGGAGGGGGGAGGG - Intergenic
926688082 2:15714100-15714122 TTGTTATTAGGAAGGGGAGATGG - Intronic
926929868 2:18026510-18026532 TTGGATAGATGGTGGGGAGAAGG + Intronic
927227955 2:20789103-20789125 TTGGATTTAGGGCATGGAGGTGG - Intronic
928231078 2:29499597-29499619 TTGGCTGGAGGGAGGCGAGAGGG - Intronic
929088138 2:38188906-38188928 TTGGAGTTGGTGAGGAGAGATGG + Intergenic
929159576 2:38818080-38818102 TTGGTTTTGGGGAGAGGGGAAGG + Intronic
929275311 2:40018876-40018898 TTGGAATTAGCCAGGGGAGTTGG + Intergenic
930380680 2:50623923-50623945 TGGGGTTGGGGGAGGGGAGAGGG - Intronic
930568204 2:53049660-53049682 TGGGGTGTAGGGAGGGGGGAAGG + Intergenic
930583933 2:53247644-53247666 TGGGATTTAAGGAAGGGAGTGGG - Intergenic
931219712 2:60278042-60278064 TAGGATTCAGGGAGAAGAGAAGG - Intergenic
931268233 2:60679449-60679471 GTAGATTTAGGGAGTGCAGAGGG - Intergenic
931531243 2:63216559-63216581 TGGTATTGGGGGAGGGGAGAGGG + Intronic
932407356 2:71522329-71522351 GTGGCTTCAGGGAGGGGAGGTGG - Intronic
932800919 2:74741688-74741710 GTGGATTAAGTGAGGGGAGGAGG - Intergenic
933194781 2:79376626-79376648 TGGGGTTGGGGGAGGGGAGAGGG - Intronic
934041545 2:88131193-88131215 TGGGATCTACGGAGGGGAGTGGG + Intergenic
935359252 2:102233572-102233594 TTATATTTAGGGAGGGGAGGGGG - Intronic
935613286 2:105048352-105048374 TGGGATGGGGGGAGGGGAGAGGG + Intronic
936945876 2:117930289-117930311 ATGGATTTAGGTTAGGGAGAAGG + Intronic
937633444 2:124128911-124128933 TGGGGTATGGGGAGGGGAGAGGG + Intronic
938454221 2:131447312-131447334 TAGGATTTGGGGAGGTGAGTGGG + Intergenic
939021090 2:136959278-136959300 TTGGCTTAAAGGAGTGGAGATGG + Intronic
939480620 2:142743074-142743096 TGGGATTGTGGGAGGGGGGAAGG - Intergenic
940073036 2:149710875-149710897 TTGGATTTAGGGCTTGGAAAGGG - Intergenic
940521029 2:154748048-154748070 TTATATTTTGGGATGGGAGATGG - Intronic
940857961 2:158744497-158744519 TTGCATTTGGGGTGGGGAGTGGG - Intergenic
941081222 2:161062852-161062874 GAGGATTTGGGGTGGGGAGAGGG + Intergenic
941182320 2:162274484-162274506 CTGCATCTAGGGAGGGGAGCTGG + Intronic
941450946 2:165659337-165659359 TTGGATTTAGGAGGAAGAGAAGG + Intronic
941725658 2:168857448-168857470 TGGGAATTGGGGTGGGGAGATGG + Intronic
941810495 2:169751088-169751110 TTGGATGTAGCAAGGGGTGAGGG - Exonic
941827903 2:169920316-169920338 TGGGGTGGAGGGAGGGGAGAGGG + Intronic
941968839 2:171328206-171328228 CTGGATAGAGGGAGAGGAGAAGG + Intronic
942534850 2:176952085-176952107 TGGGATTGGGGGAGGGGGGAGGG + Intergenic
942933137 2:181520518-181520540 CTGGATTAAAGGAGAGGAGAAGG + Intronic
943427277 2:187752282-187752304 TTTGATTTTTGGAGGGGTGAGGG - Intergenic
943979857 2:194535072-194535094 TGGGATGGGGGGAGGGGAGAGGG + Intergenic
944105994 2:196080075-196080097 TTGGAAGAAGGGAGAGGAGAGGG + Intergenic
944303250 2:198149095-198149117 TTGGATTCTGGGAGTGGAGGTGG + Intronic
944529058 2:200649717-200649739 ATGGAATTAGTGTGGGGAGATGG + Intronic
945914138 2:215684672-215684694 TGGGAGATAGGAAGGGGAGAAGG + Intergenic
947285279 2:228507250-228507272 TTTGTTTTAGAAAGGGGAGAGGG + Intergenic
947348475 2:229218697-229218719 TGGGATTTAGGGAAGAAAGAAGG + Intronic
947402101 2:229741668-229741690 ATGGGTTTTGGGTGGGGAGAGGG - Intergenic
947714364 2:232332308-232332330 GTGGAGTTAGGGAGCGGAGCAGG + Intronic
947733572 2:232443687-232443709 GTGGAGTTAGGGAGCGGAGCAGG + Intergenic
947895388 2:233666790-233666812 TGGGATTGGGGGAGGGGGGAGGG - Intronic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
948601718 2:239111343-239111365 TGGGGTGTAGGGCGGGGAGAGGG + Intronic
948655543 2:239474820-239474842 ATGAATTGAGGGAGGAGAGATGG + Intergenic
1168831151 20:845908-845930 TTGTATTGGGGGAGGGGAGGAGG - Exonic
1168853336 20:991322-991344 TTGGTTTTTGAGTGGGGAGAGGG - Intronic
1169127558 20:3140867-3140889 TGGGAGAGAGGGAGGGGAGAGGG - Intronic
1169213858 20:3782834-3782856 TCGGATTTCGGGAGGGAAGGTGG + Intergenic
1169896864 20:10513622-10513644 TTGGATTTAGGAAGAGTAGGAGG + Intronic
1169927637 20:10799500-10799522 CTGGGATTAGGGAAGGGAGAGGG - Intergenic
1170744935 20:19090955-19090977 GAGCATTTAGGGAGGAGAGAAGG + Intergenic
1170816724 20:19720483-19720505 GTGTTTTTAGGGAGGAGAGAAGG + Intronic
1171277304 20:23868784-23868806 TTTGGTTTAGAGAGGGGAGGGGG - Intergenic
1171947161 20:31388907-31388929 ATGGATTGAGGGTGGGGGGATGG - Intronic
1172659904 20:36560600-36560622 CTGGGTTGAGGGATGGGAGAAGG - Intergenic
1172957205 20:38769458-38769480 TTGGATCTGGGGAGGGAAGTCGG + Intronic
1173672224 20:44806575-44806597 GTGGGTTTGGGGAGGGGAGAAGG - Intronic
1173788249 20:45810964-45810986 TTGGAGGCAGGGAGAGGAGAAGG - Intronic
1174263492 20:49314525-49314547 TTGTCTTTAGGGAGAGGAGCTGG - Intergenic
1174384456 20:50178913-50178935 TTGAATTTGAGGAGGGGAGTAGG + Intergenic
1174870887 20:54181004-54181026 TTAGATTTAGAGATGGGAGTAGG - Intergenic
1175172511 20:57090444-57090466 CTGGATTTGGGGAGGGCGGAAGG + Intergenic
1175582704 20:60112843-60112865 TTACATTCAAGGAGGGGAGATGG - Intergenic
1176213975 20:63939577-63939599 CTGGACCTAGGGAGGGGACAGGG - Intergenic
1176643506 21:9328254-9328276 TTTGGTTTAGAGAGGGGAGGGGG + Intergenic
1177400265 21:20594558-20594580 TGGGGTGGAGGGAGGGGAGAGGG - Intergenic
1179676111 21:42983294-42983316 GGGGCTTCAGGGAGGGGAGATGG - Intronic
1180369428 22:11970966-11970988 TTTGGTTTAGAGAGGGGAGGGGG - Intergenic
1180376805 22:12101148-12101170 TTTGGTTTAGAGAGGGGAGGGGG + Intergenic
1180420765 22:12812543-12812565 TTTGGTTTAGAGAGGGGAGGGGG - Intergenic
1182169753 22:28215132-28215154 TGGGGTTGGGGGAGGGGAGAGGG + Intronic
1182322434 22:29486879-29486901 CTGGATCTGGGGAGGGGATAAGG - Intronic
1182410551 22:30181426-30181448 TTCGATTTAGGGAAAGGAGTGGG - Intergenic
1182819562 22:33203578-33203600 TTGTTTATAGTGAGGGGAGAGGG + Intronic
1183013110 22:34963470-34963492 TTGGAGGTTGGGAGGGGACAGGG + Intergenic
1183027719 22:35078495-35078517 GTGGACTTAGGGAGGGAAGGGGG + Intronic
1183085827 22:35486405-35486427 GTGGAGGTAAGGAGGGGAGAGGG - Intergenic
1183449458 22:37883988-37884010 TTGGAATTAGACAGTGGAGATGG - Intronic
1183896318 22:40972179-40972201 GTGGTATTAGGGAGGTGAGAGGG - Intronic
1184043940 22:41960457-41960479 TGGGATGTAGGGAGAGGAAAAGG + Intergenic
1184060452 22:42078146-42078168 TTGCGTTTTGGGAGGGGACATGG + Exonic
1184483884 22:44764857-44764879 TAGGACTGAGAGAGGGGAGAGGG + Intronic
949723681 3:7019450-7019472 TTGGATTTAGGGGAGAGAGAGGG - Intronic
949723771 3:7020340-7020362 TTGGAGTTAGGGGAGAGAGAGGG + Intronic
949924669 3:9031610-9031632 TTGGCCTTAGGCAGGGGAGGGGG - Intronic
949938293 3:9134540-9134562 TGAGATTCAGGGAGGGGAAATGG + Intronic
950358667 3:12434420-12434442 ATGGAGGGAGGGAGGGGAGAAGG - Intergenic
950934442 3:16824345-16824367 CTGGAGTGAGGGTGGGGAGACGG - Intronic
951460397 3:22945534-22945556 CTGGAATTAGGGAGGGAAGACGG + Intergenic
951658583 3:25036799-25036821 TTGCATTCAGGGTGGGGAGGGGG + Intergenic
952067797 3:29593008-29593030 TGGGATTGGGGGAGGGGGGAGGG + Intronic
953508395 3:43509218-43509240 TGGGGTGGAGGGAGGGGAGAGGG + Intronic
953564650 3:44021432-44021454 TTGGGTATAGGGAGGGAAGGAGG - Intergenic
953610248 3:44441784-44441806 ATGGATTTGGGGAGGGTACATGG - Exonic
954034297 3:47842559-47842581 TTAGGTTTAGGAAGGGGAGGGGG - Intronic
954613587 3:51958595-51958617 GTGGATATAGAGGGGGGAGATGG + Intronic
954901843 3:54026648-54026670 TTAGATTGAGGGAGGGAGGATGG - Intergenic
955305088 3:57822599-57822621 CAGGATTGAGGGATGGGAGATGG - Intronic
955570340 3:60298252-60298274 CTGACTCTAGGGAGGGGAGAGGG - Intronic
956071265 3:65454381-65454403 TGGGGTTGGGGGAGGGGAGAGGG + Intronic
956960103 3:74389801-74389823 TTGGATTTAGGAAGGAGAAGGGG - Intronic
957096528 3:75781959-75781981 TTTGGTTTAGAGAGGGGAGGGGG - Intronic
957259096 3:77877403-77877425 TGGGGTTTGGGGAGGGGGGAGGG - Intergenic
957620792 3:82591232-82591254 TTGCATTTAGGGAGATAAGAGGG + Intergenic
959105316 3:102058692-102058714 AAGCCTTTAGGGAGGGGAGAGGG + Intergenic
959609013 3:108273626-108273648 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
961063129 3:123849884-123849906 TAGGGTGTGGGGAGGGGAGAGGG - Intronic
962202652 3:133414211-133414233 TGGGTTTTGTGGAGGGGAGAGGG - Intronic
963606312 3:147414008-147414030 TTGCATTGGGGGAGGGGGGAGGG + Exonic
965576117 3:170220476-170220498 CTGGATTTAGGTAGAGGTGATGG + Intergenic
966199414 3:177345975-177345997 ATTGATTTAGGGAGGGTATAGGG + Intergenic
966413505 3:179666594-179666616 TTGCATTTGGGGAGTGGAGCTGG + Intronic
966534946 3:181021621-181021643 TTGGAATTAGATAGTGGAGATGG - Intergenic
967661207 3:192112713-192112735 TAACCTTTAGGGAGGGGAGAGGG + Intergenic
967724316 3:192847339-192847361 TTGTTTTTAGGGAGGGAATAAGG - Intronic
968503036 4:960028-960050 TTGTGTTCAGGGAAGGGAGAAGG - Exonic
968741288 4:2332998-2333020 TTGGATTGAAGGAGGGAGGAAGG - Intronic
971511410 4:27429708-27429730 TGGGAGGTTGGGAGGGGAGAAGG + Intergenic
971795141 4:31217485-31217507 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
972111203 4:35561646-35561668 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
972691075 4:41398864-41398886 TTGTATTTAGGGATGTGGGAGGG - Intronic
973360977 4:49164507-49164529 TTTGGTTTAGAGAGGGGAGGGGG + Intergenic
973867436 4:55127485-55127507 TTGGATAAAGGGGTGGGAGATGG + Intergenic
974111563 4:57531996-57532018 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
974377543 4:61097730-61097752 TTGGGTGGAGGGAGGGGGGAGGG - Intergenic
975383871 4:73732566-73732588 CTTGATTCAGTGAGGGGAGAGGG - Intergenic
976348649 4:84034349-84034371 TTGGAGTTAGGAAGAGGATAGGG + Intergenic
978104549 4:104885259-104885281 CTGGATTTAGGACAGGGAGACGG + Intergenic
978188534 4:105886034-105886056 TGGGATTTGGGGAGGGGAGAAGG + Intronic
979324294 4:119361123-119361145 TTAGATATAGGGAAGGGAAAGGG - Intergenic
979338937 4:119497222-119497244 TTGGATTTGGGGAGAGTAGAAGG - Exonic
980409168 4:132392196-132392218 TTGAAATTTGGGAGGAGAGATGG + Intergenic
980720118 4:136684746-136684768 TTGGCTTTAGGGAAAAGAGATGG - Intergenic
980859137 4:138479038-138479060 TGGGGTTGGGGGAGGGGAGAAGG - Intergenic
981438123 4:144750122-144750144 ATGAATTTGGGGAAGGGAGAGGG + Intergenic
982424318 4:155239452-155239474 TTGGCTTTAGGGAGGGGGGAGGG + Intergenic
983231204 4:165130650-165130672 TGGAAATTAGGGAAGGGAGAAGG - Intronic
983242134 4:165245822-165245844 TTAGATATAGGGAAGGGAAAGGG - Intronic
983663286 4:170154163-170154185 TGGGGTAGAGGGAGGGGAGAAGG - Intergenic
984599039 4:181705097-181705119 TTGGACATAGGGTGGGTAGAGGG + Intergenic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
985305435 4:188534068-188534090 TTGGATTTAGAGGGTGGGGATGG - Intergenic
1202758405 4_GL000008v2_random:86581-86603 TTTGGTTTAGAGAGGGGAGGGGG + Intergenic
985986143 5:3518206-3518228 TTGGATTCAGGGAGGAAACATGG - Intergenic
986085753 5:4444055-4444077 GGGGAGTCAGGGAGGGGAGAGGG - Intergenic
986506025 5:8452268-8452290 TTTGTTTTAGAGAGCGGAGAAGG - Intergenic
986630596 5:9768336-9768358 GAGGCTTTAGGGAGGAGAGAAGG - Intergenic
986795717 5:11210044-11210066 TTGTATTGAGGGAGTGGAGGAGG - Intronic
987427969 5:17795122-17795144 TAACCTTTAGGGAGGGGAGAGGG + Intergenic
987494592 5:18627452-18627474 TTGGGTGTGGGGAGGGGAGAGGG + Intergenic
988192432 5:27956260-27956282 TGGCATGTGGGGAGGGGAGACGG + Intergenic
989302558 5:39911094-39911116 TGGGATGGGGGGAGGGGAGAGGG + Intergenic
989460103 5:41687607-41687629 TTGGGGTTGGGGAGTGGAGAGGG - Intergenic
989539872 5:42606188-42606210 TTGGATTGAGCTGGGGGAGAAGG + Intronic
989560466 5:42844450-42844472 TTGGGTGGAGGGAGGGGGGAAGG - Intronic
989861178 5:46377240-46377262 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
990586482 5:57216329-57216351 TTGGATGTGGGGAGGGTAGCTGG + Intronic
991998086 5:72408102-72408124 TAGGAGTTAGGGAAGGGAGTTGG + Intergenic
992427520 5:76672905-76672927 TGGGATTGGGGGAGGGGGGAGGG + Intronic
992747039 5:79830162-79830184 GTGGATTTAGACAGGAGAGAAGG + Intergenic
992779001 5:80111322-80111344 TTTGGTTTAGAGAGGGGAGGGGG + Intergenic
994059736 5:95461105-95461127 TTTGTTTTAGGGAAGGGAAACGG - Intergenic
994199913 5:96961643-96961665 GTGGATTTTGGTAGGGGGGAGGG - Intronic
994402552 5:99299323-99299345 TGGGATGTGGGGAGGGGGGAGGG + Intergenic
997379553 5:133425929-133425951 TTGAAGTTAGGGTGAGGAGAAGG + Intronic
998447568 5:142210653-142210675 ATGGCATGAGGGAGGGGAGAGGG - Intergenic
999768678 5:154758032-154758054 TTGAGTTTAAAGAGGGGAGAAGG - Intronic
1000463206 5:161547306-161547328 TTGGATTTGGGGCGGGGGGTTGG + Intronic
1000611935 5:163383916-163383938 TTGGTCTAAGGGAGGGGACATGG - Intergenic
1000833834 5:166132523-166132545 TTGAATTTAGGAAGGAGAGAGGG + Intergenic
1001781680 5:174374197-174374219 ATGGATTGAAGGAGGAGAGAAGG + Intergenic
1001898626 5:175403638-175403660 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1001995895 5:176157784-176157806 ATGGATGTGGGGCGGGGAGATGG - Intergenic
1002637421 5:180615253-180615275 GTGGATTTCGGAAGTGGAGATGG - Intronic
1002637448 5:180615356-180615378 GTGGATTTCGGAAGTGGAGAAGG - Intronic
1002637473 5:180615458-180615480 GTGGATTTCGGAAGTGGAGAAGG - Intronic
1002637534 5:180615694-180615716 GTGGATTTCGGAAGTGGAGAAGG - Intronic
1003077012 6:2991049-2991071 TTTGGTTTAGACAGGGGAGAGGG - Intronic
1003370676 6:5522988-5523010 TGGGATGAAGGGAGGAGAGAAGG + Intronic
1004832096 6:19487729-19487751 TGGGGTTGGGGGAGGGGAGAAGG + Intergenic
1004872667 6:19922982-19923004 TTGCATTTAGGGCGGGGGGTGGG - Intergenic
1005161557 6:22870293-22870315 TTGGGTGTGGGGAGGGGGGAGGG + Intergenic
1005434399 6:25792833-25792855 TAGGATGTAGGCAGGGGAGAGGG - Intronic
1005844326 6:29765769-29765791 CTGGAGTTAGGTAGGGGACATGG - Intergenic
1006090779 6:31627433-31627455 TTGGGTTTCGGAAGGAGAGAGGG + Intronic
1006178395 6:32137994-32138016 TTGGATTAGGGTAGAGGAGAGGG + Intergenic
1006407727 6:33855054-33855076 TTAGATTTGGGGAGGGGACCAGG + Intergenic
1006808416 6:36804331-36804353 TTGAATTTAGGGAGTGGGAAAGG - Intronic
1007178694 6:39913280-39913302 ATGGGTTGAGGGAGGGAAGAAGG - Intronic
1007765818 6:44159160-44159182 TTGGAGTTGGGGAGAGGAGAGGG + Intronic
1007795936 6:44347224-44347246 TGGGGTTGGGGGAGGGGAGAAGG + Intronic
1008262551 6:49384979-49385001 ATGGATTTTGGGAGGTGGGAGGG + Intergenic
1008486642 6:52043235-52043257 TTGAATTTTGGGAGGGGATGGGG - Intronic
1009026087 6:58001756-58001778 GTGGATTTATGGCAGGGAGAAGG + Intergenic
1009206089 6:60803629-60803651 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1009457393 6:63873143-63873165 TGGGGTGTAGGGAGGGGGGAGGG - Intronic
1010159167 6:72831579-72831601 TGGGATGCAGGGAGGGGGGAGGG + Intronic
1010208837 6:73347066-73347088 GTGGATTTTGGTATGGGAGAGGG - Intergenic
1010359516 6:74976554-74976576 TTGGAATTAGGGATGGTAGCAGG - Intergenic
1010361471 6:74999847-74999869 TGGGATTGGGGGAGGGGGGAGGG + Intergenic
1010774181 6:79866091-79866113 TAGGAGTTAGGTAGGAGAGAAGG - Intergenic
1011194757 6:84769255-84769277 TTGGAGAAAGGAAGGGGAGAAGG + Intergenic
1011863475 6:91791277-91791299 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1012271891 6:97223405-97223427 TTGGGTTTAGGTAAGGAAGATGG - Intronic
1012505642 6:99943476-99943498 TGGGGTTGGGGGAGGGGAGAGGG - Intronic
1012535629 6:100293231-100293253 ATGGGTCTTGGGAGGGGAGAGGG - Intergenic
1014140713 6:117938923-117938945 CTGGATTCAGGGAGGACAGAGGG - Intronic
1014145175 6:117989155-117989177 TGGGATTTGGGGAGTGGACAGGG - Intronic
1014150146 6:118044891-118044913 TCTAATTTAGGAAGGGGAGAGGG + Intronic
1014165834 6:118223643-118223665 TTGGCATTTGGGATGGGAGATGG + Intronic
1014217029 6:118762261-118762283 CTGGATGGAGGGAGGGGACAAGG - Intergenic
1014596287 6:123344433-123344455 TAGGGTTTGGGGAGGAGAGAAGG - Intronic
1014750147 6:125246014-125246036 GTGGAATTAGGGAGGGGTCATGG - Intronic
1015239419 6:131006970-131006992 TTGGAGGTAGGGAGGGGCAAAGG - Intronic
1015673795 6:135722575-135722597 TTGGAGTCAGGGAGGGGAAAAGG - Intergenic
1016630539 6:146224957-146224979 CTGTATTTGGGGTGGGGAGAAGG - Intronic
1017117748 6:150995141-150995163 CTGGACTTAGGGATGGGGGAGGG + Intronic
1017486105 6:154903141-154903163 TTGGATTTCTGTAGGTGAGAGGG + Intronic
1017707013 6:157132765-157132787 CTTCAATTAGGGAGGGGAGAAGG - Intronic
1018199247 6:161379980-161380002 TGGGATTTAGGGCAGTGAGAAGG - Intronic
1018208032 6:161453786-161453808 TTGAATTTGGGGAGAGGGGAAGG - Intronic
1018571925 6:165220913-165220935 AAGGATTTAGGGAGGGGACTGGG + Intergenic
1018609750 6:165636614-165636636 TTGCATTTAGGGTGGGAAGCTGG - Intronic
1021566813 7:22024315-22024337 TTGGGTTTGCGGAGGGGAAAGGG - Intergenic
1022592730 7:31681227-31681249 GTGGATTGAGGCAGGGAAGATGG - Intergenic
1023279226 7:38552916-38552938 TTGGATTTGGGGCTGGCAGAAGG - Intronic
1023319574 7:38978731-38978753 TTGTATCTAGGGAGGTGAGCTGG + Intronic
1023927096 7:44677432-44677454 CAGGATTTAGGGAGGTGGGAAGG + Intronic
1026178217 7:68016351-68016373 ATGGATGGAGGGAGGGAAGAGGG - Intergenic
1028416207 7:90583152-90583174 TTGGATTGTGGGATTGGAGAGGG - Intronic
1028873649 7:95796175-95796197 GTGTGTTTAGTGAGGGGAGAAGG + Intronic
1030472282 7:109980210-109980232 TGGGGTTGAGGGAGGGGGGAGGG - Intergenic
1030709761 7:112736455-112736477 TTGGGTGTGGGGAGGGGGGAAGG - Intergenic
1031210961 7:118825576-118825598 TTGCATTTGGGAAGGGGAGAAGG - Intergenic
1031269794 7:119634179-119634201 TGGGATGGGGGGAGGGGAGATGG - Intergenic
1031276075 7:119724846-119724868 TTTGATATAGGAAGGAGAGAGGG - Intergenic
1031358408 7:120817129-120817151 TTGGGTTTTGGGAGGTGGGAGGG + Intronic
1031930807 7:127683921-127683943 TAGCATTCAGGGAGAGGAGAGGG + Intronic
1032509624 7:132462133-132462155 TTGGAAGTAGGGGGAGGAGAAGG + Intronic
1033220244 7:139522913-139522935 TTGGATTTGGGGGAGGGAGCAGG + Intergenic
1033445773 7:141420658-141420680 TTTGAAGGAGGGAGGGGAGAAGG + Intronic
1033483349 7:141763222-141763244 TTAAATTTAGGGAAGGGAGTAGG + Intronic
1034211472 7:149367294-149367316 TAGCATCTAGGGTGGGGAGAGGG + Intergenic
1037251097 8:16895152-16895174 CTGAATTTAGGTAGAGGAGATGG + Intergenic
1037445278 8:18959299-18959321 TTGGATGTTCGGAAGGGAGATGG - Intronic
1037685691 8:21137692-21137714 TGGGATAAAGGGAGGGGGGAAGG + Intergenic
1037713121 8:21371499-21371521 TTAGATTAAGGGTGGAGAGAAGG - Intergenic
1037939296 8:22939781-22939803 TTGGATAAATGGAGGGGTGAGGG - Intronic
1038711090 8:29946444-29946466 TGGGGGTTAGGGAGAGGAGAAGG - Intergenic
1038970142 8:32624322-32624344 TTGGGGTTAGTGAGGGCAGATGG + Intronic
1039740406 8:40377760-40377782 CTGAGTTTAGGGAAGGGAGATGG + Intergenic
1040655808 8:49506242-49506264 TTGGGTTGGGGGAGGGGGGAAGG + Intergenic
1040787956 8:51189058-51189080 TTGGATTCAGTGATGGGGGAAGG - Intergenic
1040924534 8:52664669-52664691 TTGGATTCAGGGAGGTTAAATGG + Intronic
1041008496 8:53518728-53518750 TTATTTTCAGGGAGGGGAGAAGG + Intergenic
1042217316 8:66439238-66439260 TTGAATTTTTGGCGGGGAGAAGG + Intronic
1042253418 8:66778761-66778783 CTGGATTTATAGAGGGGAGTGGG + Intronic
1042788699 8:72579560-72579582 ACGGATTAAGGGAGGGCAGAGGG - Intronic
1043191883 8:77234903-77234925 TTGGATTTTCAGATGGGAGATGG - Intergenic
1043527863 8:81115655-81115677 TGGAATTTAGGGATGGAAGAAGG + Intergenic
1043658275 8:82701410-82701432 TGGGATGGGGGGAGGGGAGAGGG - Intergenic
1043889569 8:85641798-85641820 GTGGATTTAGGGAGGCATGATGG + Intergenic
1044179890 8:89178728-89178750 TTTGGTTTAGGAAGGGGAGGGGG + Intergenic
1044433701 8:92137515-92137537 ATGGAGTTTGGGAGGGGAGGAGG - Intergenic
1044482286 8:92705276-92705298 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1046520684 8:115321184-115321206 TTGTATTTTGGGGGGGGAGGTGG - Intergenic
1048260803 8:132943603-132943625 TTGGATTTTAAGAAGGGAGAAGG - Intronic
1048345676 8:133572540-133572562 TGGGATTTAGGGAGGGGGAAGGG + Intergenic
1048414372 8:134209957-134209979 TCGGGGTTAGGGAGGTGAGAGGG - Intergenic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1049077644 8:140412214-140412236 TTGCATTTTGGCAGGGCAGAAGG - Intronic
1050084455 9:1950054-1950076 AGGGATTTAAGGAGGGGAGAAGG + Intergenic
1050809874 9:9731600-9731622 TGGGGTGTAGGGAGGGGGGAAGG - Intronic
1051664810 9:19458587-19458609 TCAGATCTGGGGAGGGGAGAAGG + Intergenic
1051887317 9:21907047-21907069 TTGGGTTAAGGGAGGTGAGTGGG + Intronic
1052330464 9:27262159-27262181 TTGGAGCTAGGTAGGGGGGAGGG - Intergenic
1052984513 9:34476671-34476693 TAGTATTGAGGGAAGGGAGAAGG + Intronic
1053143653 9:35697611-35697633 TTGGGGTTGGGGAGGGGACAGGG + Exonic
1053247870 9:36550002-36550024 TTGTATTTATGGAGGAGACAGGG + Intergenic
1053507788 9:38659098-38659120 TTGGGTTGAGGGTGGTGAGAGGG + Intergenic
1056740635 9:89251383-89251405 TGGGGTTTGGGGAGAGGAGAAGG - Intergenic
1057242844 9:93427331-93427353 TTATATTTGGGCAGGGGAGAGGG + Intergenic
1057710004 9:97431699-97431721 TTGGATTTATGGGGAAGAGACGG + Intronic
1058494660 9:105543574-105543596 TGGGGTTGGGGGAGGGGAGAGGG - Intronic
1059360635 9:113739582-113739604 TTGGAGTCAGGGTTGGGAGAGGG - Intergenic
1059360643 9:113739621-113739643 TTGGAGTCAGGGTTGGGAGAGGG - Intergenic
1059360698 9:113739861-113739883 TTGGAGTCAGGGTTGGGAGAGGG - Intergenic
1059360732 9:113740023-113740045 TTGGAGTCAGGGTTGGGAGAGGG - Intergenic
1059360751 9:113740103-113740125 TTGGAGTCAGGGTTGGGAGAGGG - Intergenic
1059360821 9:113740431-113740453 TTGGAGTTAGTGTTGGGAGAGGG - Intergenic
1059360828 9:113740471-113740493 TTGGAGTCAGGGTTGGGAGAGGG - Intergenic
1059360881 9:113740717-113740739 TTGGAGTCAGGGTTGGGAGAAGG - Intergenic
1059360889 9:113740757-113740779 TTGGAGTCAGGGTTGGGAGAGGG - Intergenic
1059360898 9:113740797-113740819 TTGGAGTCAGGGTTGGGAGAGGG - Intergenic
1059360925 9:113740921-113740943 TTGGAGTCAGGGTTGGGAGAGGG - Intergenic
1059915119 9:119091036-119091058 TTGGATTGAGGTAGGGGGGTGGG - Intergenic
1060149540 9:121279464-121279486 TTGGCATTGGGGTGGGGAGAAGG + Intronic
1060198362 9:121637567-121637589 TTGGAGGAAGGGAGGGGAGAGGG + Intronic
1061261374 9:129482651-129482673 TTTGAGTTATGGAGGGGGGAGGG + Intergenic
1061710523 9:132484336-132484358 TTGGAATTAGAGAGGGGTGATGG - Intronic
1061798474 9:133101882-133101904 ATGGATTTGGAGTGGGGAGATGG + Intronic
1061963315 9:133998963-133998985 ATGGGTTGAGGGATGGGAGAAGG - Intergenic
1062585200 9:137246127-137246149 TTGGAATGAGGGGTGGGAGAGGG - Intronic
1203690013 Un_GL000214v1:33596-33618 TTTGGTTTAGAGAGGGGAGGGGG + Intergenic
1203712012 Un_KI270742v1:106739-106761 TTTGGTTTAGAGAGGGGAGGGGG - Intergenic
1203539194 Un_KI270743v1:71453-71475 TTTGATTTAGAGAGGGGAGGGGG + Intergenic
1203555617 Un_KI270743v1:205066-205088 TTTGGTTTAGAGAGGGGAGGGGG - Intergenic
1203646262 Un_KI270751v1:70457-70479 TTTGGTTTAGAGAGGGGAGGGGG - Intergenic
1185612794 X:1402447-1402469 CTGAATTTTGGGAGGGGGGAAGG - Intergenic
1185612892 X:1402785-1402807 CTGCATTTGGGGAGGGGGGAAGG - Intergenic
1186172696 X:6894095-6894117 TTGGAGTGGGGGATGGGAGAGGG + Intergenic
1186654483 X:11598130-11598152 TTGGATGTAGGGTGGGCACATGG + Intronic
1186682175 X:11886641-11886663 TCTGTTTTAGGAAGGGGAGATGG - Intergenic
1187635036 X:21218760-21218782 TGGGGTGTAGGGAGGGGGGAGGG - Intergenic
1187678633 X:21743537-21743559 TTGGCTGAAGGGAAGGGAGAAGG + Intronic
1188096957 X:26034920-26034942 TGGGGTTGAGGGAGGGGGGAAGG + Intergenic
1189132966 X:38519296-38519318 TTGGTTTTAGGCAGGGGAGGAGG - Intronic
1189167101 X:38870882-38870904 TGGGAGTTAGGGGTGGGAGAGGG + Intergenic
1189204228 X:39224011-39224033 TTGGATTCAGGGAGGATAGCTGG + Intergenic
1189249800 X:39591832-39591854 ATAGATTTAGGGAGGGCTGAAGG + Intergenic
1189525409 X:41814591-41814613 TTGGGTGGAGGGAGGGGGGAGGG + Intronic
1190378170 X:49811644-49811666 CTGGTTGTAGGGAGGGGAGCAGG + Intergenic
1191233248 X:58114090-58114112 TGGGATGGAGGGAGGGGGGAGGG + Intergenic
1191840912 X:65513176-65513198 TTGGGTTGAGGTAGGGGAGGGGG + Intronic
1191871641 X:65751347-65751369 TTGGAGTTAGGGAAGAGAAAAGG - Intergenic
1192061981 X:67837397-67837419 TGGGGTTGAGGGAGGGGGGAGGG + Intergenic
1192151353 X:68714817-68714839 TGGGACTTAGGGAGGGGAGAGGG - Intronic
1192904491 X:75536437-75536459 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1193310623 X:80005137-80005159 TTTCATTTATGGAGGTGAGATGG + Intergenic
1193669695 X:84369073-84369095 TGGGGTTTGGGGAGGGGAAATGG - Intronic
1194358728 X:92920109-92920131 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1194683002 X:96876760-96876782 TGGGGTTTGGGGAGGGGGGAGGG + Intronic
1195380289 X:104264223-104264245 TAGAATTTAGGGATGGGAAAGGG + Intergenic
1195957329 X:110345345-110345367 TGGGGTTGGGGGAGGGGAGAGGG + Intronic
1196287071 X:113895489-113895511 TTGGATAGAGGGAGGACAGAAGG - Intergenic
1196855292 X:119977183-119977205 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1196892580 X:120305679-120305701 GGGGATAGAGGGAGGGGAGAGGG + Intronic
1196899341 X:120367846-120367868 TGGGAATTGGGGAGGGGTGAAGG - Intronic
1197074075 X:122334872-122334894 TTGGATTAATAGATGGGAGATGG - Intergenic
1197646957 X:129028095-129028117 TTGAATAAAGGGAAGGGAGAGGG - Intergenic
1198478469 X:137018331-137018353 TTGCAATTAGGGAAGGGAAAGGG + Intergenic
1198683202 X:139203575-139203597 TTGCATTGGGGGCGGGGAGAGGG + Intronic
1199101668 X:143808886-143808908 TGGGGTTGGGGGAGGGGAGAGGG - Intergenic
1199367370 X:147002814-147002836 TTTGGTTTAGAGAGGGGAGGAGG - Intergenic
1199527219 X:148806034-148806056 GTGGATTTAAAGAGAGGAGAAGG + Intronic
1199748054 X:150787745-150787767 TGGGATTGGGGGAGGGGGGAGGG + Intronic
1200345185 X:155440586-155440608 TTGAATTTTGGGAGGGGCCAGGG - Intergenic
1200666897 Y:6035799-6035821 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1201740371 Y:17317564-17317586 TGGGGTTGGGGGAGGGGAGAGGG + Intergenic