ID: 1147422354

View in Genome Browser
Species Human (GRCh38)
Location 17:40328174-40328196
Sequence TGCCAAGGCCACTGTGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147422354_1147422358 -4 Left 1147422354 17:40328174-40328196 CCTCTTCCACAGTGGCCTTGGCA 0: 1
1: 0
2: 1
3: 33
4: 303
Right 1147422358 17:40328193-40328215 GGCAGGAACTCCCCCTTCCCAGG 0: 1
1: 0
2: 3
3: 39
4: 326
1147422354_1147422367 19 Left 1147422354 17:40328174-40328196 CCTCTTCCACAGTGGCCTTGGCA 0: 1
1: 0
2: 1
3: 33
4: 303
Right 1147422367 17:40328216-40328238 CCTGGTCTTCAACCAAATGCTGG 0: 1
1: 0
2: 0
3: 9
4: 104
1147422354_1147422359 1 Left 1147422354 17:40328174-40328196 CCTCTTCCACAGTGGCCTTGGCA 0: 1
1: 0
2: 1
3: 33
4: 303
Right 1147422359 17:40328198-40328220 GAACTCCCCCTTCCCAGGCCTGG 0: 1
1: 0
2: 3
3: 30
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147422354 Original CRISPR TGCCAAGGCCACTGTGGAAG AGG (reversed) Intronic
900218759 1:1495927-1495949 TGCCCAGGCCACTGTGAGGGTGG + Exonic
900226116 1:1534368-1534390 TGCCCAGGCCACTGTGAGGGTGG + Exonic
901094812 1:6669652-6669674 TGGAAAGGCCACCGTGAAAGAGG + Intronic
903042210 1:20539800-20539822 TGTCCAGGCCACTGTGGAGTTGG + Intergenic
903240817 1:21981415-21981437 TGCCAAGGCCACTTGGCTAGTGG + Intronic
903244554 1:22006055-22006077 TGCCAAGGCCACTTGGCTAGTGG + Intronic
903392324 1:22973102-22973124 TGCCAAACCCAGTGTGGAAAAGG + Intergenic
903647471 1:24903977-24903999 TTGCAAGGCCACTGTGGCTGTGG + Intronic
903929042 1:26851717-26851739 TGACAGGGGCAGTGTGGAAGAGG - Intronic
905530857 1:38677584-38677606 TGGCCTGGCCACTGTGGATGTGG - Intergenic
905537004 1:38729999-38730021 TACCAGGGCTTCTGTGGAAGCGG - Intergenic
906519696 1:46459730-46459752 GGCCAAGGCCACTGTTGCAAGGG + Intergenic
906950740 1:50333114-50333136 TCCCAAGGACAGTGTGGACGCGG - Intergenic
907460412 1:54602203-54602225 TGCCAAGGCCACAGGGGTAAGGG - Intronic
907478478 1:54725004-54725026 TTTCAAGGCTACTGTGGAACTGG - Intronic
908857412 1:68446215-68446237 TGGAAAGGCCACTGGGAAAGGGG - Intronic
908924643 1:69239542-69239564 TGCCAAGCCCAGTGTTGAGGAGG + Intergenic
908986016 1:70023135-70023157 TGCCAAGCCCCCTGGGAAAGGGG + Exonic
909353949 1:74685721-74685743 TGCCAAATCCACTGTGAGAGAGG + Intergenic
910518764 1:88093627-88093649 TGCAAAGGCTACCATGGAAGTGG - Intergenic
910778181 1:90897294-90897316 TGCCAATGACAATGTGGGAGAGG + Intergenic
911151481 1:94600612-94600634 AGCCAAGGTCACTGGGGAGGAGG + Intergenic
911554514 1:99327237-99327259 TGTCAAGGCATGTGTGGAAGTGG - Intergenic
912435684 1:109659491-109659513 AGCCCAGGGCACTTTGGAAGAGG + Intronic
912437577 1:109672594-109672616 AGCCCAGGACACTTTGGAAGAGG + Intronic
912440063 1:109690945-109690967 AGCCCAGGACACTTTGGAAGAGG + Intronic
912565357 1:110583805-110583827 TGCCAAGGTCACTGAGCATGAGG - Intergenic
913709085 1:121462595-121462617 TTCCAGTGCAACTGTGGAAGTGG + Intergenic
915603494 1:156937048-156937070 TCCTAAGGCCCCTGGGGAAGGGG + Intronic
915924990 1:160010487-160010509 TGCCAAACACATTGTGGAAGGGG - Intergenic
916354422 1:163888843-163888865 GGCCAAGGTCACTGTGTAAAGGG - Intergenic
916933935 1:169608367-169608389 TGCCAAGGGCTCGGCGGAAGAGG - Intronic
917358669 1:174153304-174153326 CGCCCAGGCCACAGTGGAAGTGG - Intergenic
917645986 1:177029236-177029258 ACCCAAGGCCAATGTGGTAGAGG + Intronic
919430585 1:197486864-197486886 TGCCACGGCCACTGTGGGGATGG - Intergenic
919761192 1:201099260-201099282 TGACCAGGCCACTGTGCTAGGGG - Intronic
920540390 1:206773765-206773787 AGGCAAAGCCCCTGTGGAAGGGG - Intergenic
920965286 1:210696180-210696202 TGCCAGGACCTCTGAGGAAGAGG - Intronic
921540390 1:216406947-216406969 TGCCAATTTCACTGTGGTAGAGG - Intronic
924795409 1:247289024-247289046 TGCCATGGGGAATGTGGAAGTGG - Intergenic
1062797400 10:354836-354858 TGCCAAGACCACAGGGAAAGAGG + Intronic
1062818789 10:518932-518954 TGACACGGCCACCATGGAAGTGG - Intronic
1062823443 10:551391-551413 TGCCACGGAGGCTGTGGAAGGGG + Intronic
1064810409 10:19191404-19191426 TGGCATAGCTACTGTGGAAGAGG + Intronic
1066126717 10:32348820-32348842 AGCCCAGGCCACTGTGGGAAGGG + Intronic
1067140376 10:43651267-43651289 TGCAAAGGAGACTGGGGAAGTGG + Intergenic
1069573204 10:69506921-69506943 TGCCAAGCCCAGCGTGGAGGCGG + Exonic
1070964465 10:80521109-80521131 TGCAGAGGCCACTGGGGAGGTGG + Exonic
1071062084 10:81583521-81583543 TGCCAAGGCCAGTGTTGAGAAGG - Intergenic
1071344704 10:84681961-84681983 AGCCAGGGCCACTGTGGAACAGG + Intergenic
1071463794 10:85921792-85921814 AGCCAAGGACACAGAGGAAGGGG - Intronic
1071555857 10:86600820-86600842 TGCCTAGGAGACAGTGGAAGAGG + Intergenic
1072268855 10:93756045-93756067 TGTCAAGGACTCTGTGGAGGAGG - Intergenic
1073348657 10:102803201-102803223 TGCCACTGCCACAGTGGAAAAGG - Intronic
1076331969 10:129676494-129676516 TGCGAGGGTCCCTGTGGAAGTGG + Intronic
1076545766 10:131244931-131244953 TGCCCAGGACACTGGGGAACAGG + Intronic
1076630656 10:131850018-131850040 TCCCAAGGCCTCTCAGGAAGTGG - Intergenic
1078885491 11:15495898-15495920 TGCTAAGGCCACTGTGGCATGGG - Intergenic
1080215957 11:29840930-29840952 TGCCAAGGCCAATGTTGAAAAGG + Intergenic
1080553055 11:33390636-33390658 TACCAAGGCCATGGTGAAAGGGG - Intergenic
1081541803 11:44040035-44040057 TGCCAAGGCCACACAGGCAGGGG + Intergenic
1083488758 11:62999721-62999743 TGCCAAAGCCACACAGGAAGCGG + Exonic
1083565141 11:63708160-63708182 TTCAAAGGCCTGTGTGGAAGTGG - Intronic
1083658921 11:64243165-64243187 TGAGAAGGCCAGTGAGGAAGAGG - Intronic
1084715355 11:70870125-70870147 GGCCCAGGGCACTATGGAAGAGG + Intronic
1087107760 11:94428458-94428480 TGCCAAGGCCAGTGTTGAGAAGG - Intronic
1087155838 11:94902241-94902263 TGCCAAGGCCAGTGTTGAGAAGG + Intergenic
1087209451 11:95431866-95431888 TGCTAAAGCCACTGGAGAAGGGG + Intergenic
1087757853 11:102073720-102073742 TGCCATGGCCACTGTTGCTGGGG - Intronic
1089125944 11:116176688-116176710 TGCAAAGGGCACAGCGGAAGTGG - Intergenic
1090140635 11:124256371-124256393 TGCTCAGGCCACTGTAAAAGGGG + Intergenic
1091031737 11:132195876-132195898 TGCCAAGGCCAATGTCCAGGAGG - Intronic
1091631036 12:2161238-2161260 TGCCAAAGGCAGTGTGGATGTGG + Intronic
1092260409 12:6950590-6950612 TGTCCATGCCACTGTGGCAGAGG - Intronic
1096477951 12:51920224-51920246 GGCCCAGGGGACTGTGGAAGTGG - Intronic
1097831502 12:64229363-64229385 TGAAAGAGCCACTGTGGAAGGGG - Intergenic
1097874749 12:64632634-64632656 TGGCCATGCCACTGTGGAATGGG + Intronic
1098962528 12:76753701-76753723 TGCCAAGGCTCCTGTTGAGGAGG - Intergenic
1099083180 12:78211822-78211844 CGGTAAGGTCACTGTGGAAGAGG + Exonic
1102821724 12:115914501-115914523 TGCCAAGGCCAATGTCAAAAAGG + Intergenic
1103480362 12:121246672-121246694 TGACAAGGCCACAGGGGAGGCGG - Intronic
1104715950 12:131016301-131016323 TGCCAAGGCCACTGCGGGCAGGG - Intronic
1105864407 13:24446419-24446441 TCCCTGGGCCACAGTGGAAGAGG + Intronic
1105900886 13:24752288-24752310 TGCCAATGGCCATGTGGAAGTGG - Intergenic
1106006519 13:25775239-25775261 AGCCAAGGACACAGAGGAAGAGG - Intronic
1107640043 13:42432909-42432931 TGCAAAGGCCCCTGAGGTAGAGG - Intergenic
1108590688 13:51910624-51910646 TGCCAAGGCTGCTCTGGCAGTGG + Intergenic
1109443175 13:62400579-62400601 TGGCAAGGCAAGTGAGGAAGAGG + Intergenic
1110743830 13:79029476-79029498 TTCAAAGGCTACTGTGGAAAGGG - Intergenic
1111877310 13:93913317-93913339 AGCCAAGGCCTCTGTGCAAAGGG - Intronic
1112982796 13:105407409-105407431 TGCAAATGCCACTGGGAAAGGGG - Intergenic
1114654432 14:24307686-24307708 TGACAAGCCCACTGTGGAGTGGG + Exonic
1116132106 14:40867365-40867387 TGCCAAGGCCAGTGTCGATAAGG - Intergenic
1117729402 14:58706515-58706537 TGCAATGGCCCCTTTGGAAGTGG - Intergenic
1118625362 14:67654063-67654085 TACCAAGGCCACTGGGGAATGGG - Intronic
1119532909 14:75375611-75375633 TGCCAATGCCTGAGTGGAAGAGG + Intergenic
1120556587 14:85935374-85935396 TGCCAAGGCCAGTGTTGAGAAGG + Intergenic
1121637498 14:95463625-95463647 TGCCAAGGCCCGTGTGGCATGGG - Intronic
1122105260 14:99448302-99448324 TGCCACTGCCACTGTGACAGTGG - Intronic
1125919739 15:43518328-43518350 TGCCGAGGCCACTCTGGAGACGG + Intronic
1126369244 15:47928349-47928371 TCCAAAGGCCACTGCGGAAGGGG - Intergenic
1126682213 15:51213476-51213498 TGCCAAGGGCAGTATGTAAGAGG - Intronic
1128853131 15:70982312-70982334 TATCAAGGCCACTTTGAAAGAGG - Intronic
1132153793 15:99480915-99480937 TGCCAAGGCCAAGGGAGAAGGGG - Intergenic
1132364048 15:101243090-101243112 TGCCCAGGCCATTGTTGAAGTGG - Intronic
1132573195 16:652953-652975 GCCCAAGGCCACTGAGGCAGAGG - Intronic
1132869563 16:2109778-2109800 AGCCAACGCCACCGTGGAAGTGG - Exonic
1132870505 16:2113713-2113735 TCCCAAGGCCCCTGGTGAAGAGG + Intronic
1133011645 16:2915893-2915915 TTCCTTGGCCACTGTAGAAGAGG - Intronic
1133201687 16:4207736-4207758 GGCCAAGGGGCCTGTGGAAGAGG - Intronic
1134522028 16:14923190-14923212 TCCCAAGGCCCCTGGTGAAGGGG - Intronic
1134709697 16:16321841-16321863 TCCCAAGGCCCCTGGTGAAGGGG - Intergenic
1134716910 16:16361871-16361893 TCCCAAGGCCCCTGGTGAAGGGG - Intergenic
1134717854 16:16365821-16365843 AGCCAACGCCACCGTGGAAGTGG + Intergenic
1134949906 16:18346804-18346826 TCCCAAGGCCCCTGGTGAAGGGG + Intergenic
1134956896 16:18386338-18386360 AGCCAACGCCACCGTGGAAGTGG - Intergenic
1134957841 16:18390288-18390310 TCCCAAGGCCCCTGGTGAAGGGG + Intergenic
1135063836 16:19292579-19292601 TGCCAAGGCACCAGAGGAAGAGG + Intronic
1135099915 16:19596313-19596335 TGCCCAGGCCACAGTGCAATGGG + Intronic
1135235723 16:20754009-20754031 TGTCAAGTCCACAGTGGAAAAGG + Intronic
1135519192 16:23160598-23160620 TGCCGAGAACACTGTAGAAGAGG - Intergenic
1136549780 16:30976786-30976808 TGCCAAGTCCCCTGGGGAGGTGG + Intronic
1136672781 16:31873404-31873426 TGCTAACGCCACCGTGGGAGGGG - Intergenic
1137388511 16:48061774-48061796 TGCAAAACCCACTGTGGAGGCGG + Intergenic
1139252190 16:65506947-65506969 TGCCAAGACCACCATGAAAGAGG - Intergenic
1140558719 16:75952118-75952140 TGTCTAGGCTACTGTGAAAGAGG - Intergenic
1141214809 16:82013174-82013196 TGCCAAGGTCACTACAGAAGAGG + Intergenic
1142008602 16:87702228-87702250 TGGCAGAGCCACTGTGGAGGAGG - Intronic
1142134171 16:88444077-88444099 TTCCAAGGCCGCTGGGGAAGTGG + Intergenic
1142848746 17:2694381-2694403 GGCCAGGGCCACAGGGGAAGTGG - Intronic
1144021665 17:11243765-11243787 GGCCAAGGCCACAGGGGAAGGGG - Intronic
1144635578 17:16906370-16906392 TGCCAAGGCCAATGTCGAGAAGG + Intergenic
1144860682 17:18299609-18299631 TCCCATGGCAACTGTGGTAGAGG - Exonic
1147422354 17:40328174-40328196 TGCCAAGGCCACTGTGGAAGAGG - Intronic
1150641546 17:66953080-66953102 TCCCAAGGCCCCTGTGGAAAAGG - Intergenic
1152354321 17:79799323-79799345 CTCCAGGGCCACTGTGGAAGTGG + Intronic
1153784109 18:8518954-8518976 ACCCATGGCCACTCTGGAAGTGG + Intergenic
1153975983 18:10268777-10268799 TTCCAAGGACACTGTCGAACAGG - Intergenic
1155261261 18:24044643-24044665 TCCAAAGGCCACTGAGGAAGAGG + Intronic
1155333445 18:24740944-24740966 TGCCATGGCCACTGTAGGGGAGG - Intergenic
1156028770 18:32688825-32688847 TAGGAGGGCCACTGTGGAAGAGG + Intronic
1157154895 18:45255827-45255849 TGCCAAGGACACCATTGAAGGGG - Intronic
1157593589 18:48850701-48850723 TGCCAAGGGCCCCCTGGAAGAGG + Intronic
1158127714 18:54120366-54120388 TGCCAAGGTCACTGGTGATGTGG - Intergenic
1159216949 18:65404708-65404730 TGTCAAGGCCACTGTTGAGAAGG - Intergenic
1160629873 18:80239315-80239337 TGCCCAGGCAACTCTGCAAGAGG + Intronic
1163368818 19:16890558-16890580 CTCCAAGGCCTCTGCGGAAGGGG + Exonic
1163488343 19:17602744-17602766 TGCCCAGGTCCGTGTGGAAGGGG + Exonic
1164146488 19:22515638-22515660 GGTCAAGGCCTCTGTGTAAGAGG - Intronic
1164159878 19:22619496-22619518 GGTCAAGGCCTCTGTGTAAGAGG + Intergenic
1164561158 19:29293183-29293205 GGACAGTGCCACTGTGGAAGAGG + Intergenic
1164611680 19:29636685-29636707 TGGCAAGGCCCCAGTGGGAGTGG + Intergenic
1165774311 19:38395764-38395786 TGCCAAGGCCTCCCCGGAAGCGG + Exonic
1166342985 19:42149937-42149959 GGCCAAGTTCAGTGTGGAAGGGG + Intronic
1166735571 19:45082214-45082236 TAGCAAGGCCAGTGTGGAGGAGG - Intronic
1166769679 19:45273874-45273896 GGCCAAGGCCACTGTGAAGAAGG - Intronic
1167123211 19:47531502-47531524 TCCCAAAGCCGCTGTGGAGGAGG + Intronic
1167787837 19:51650352-51650374 CTCCAAGGACACAGTGGAAGTGG + Intergenic
925063563 2:911966-911988 ACCGAAGGCCGCTGTGGAAGGGG + Intergenic
925184364 2:1836891-1836913 TGCCAGGGACCCTGGGGAAGAGG + Intronic
925192450 2:1895757-1895779 TGCCAAGGCCAGTGTTGAAAAGG - Intronic
926473274 2:13288852-13288874 TGCCAAGGCCAATGTTGAGAAGG + Intergenic
928196321 2:29219044-29219066 TGCCATGGCCACACAGGAAGTGG - Intronic
930209958 2:48625937-48625959 TGCCAAGGCCATTGTCAAACAGG + Intronic
932033621 2:68216677-68216699 TCCCAAGATCACTGAGGAAGAGG - Intronic
932071580 2:68626095-68626117 TGACAAGACCACAGTGGCAGAGG + Intronic
933223654 2:79719963-79719985 TGCCAAGGCCAATGTTGAGAAGG + Intronic
934538577 2:95157049-95157071 TGTCACAGCCACAGTGGAAGAGG - Intronic
934557453 2:95294894-95294916 TGGATAGGCCACTGAGGAAGGGG + Intergenic
934646599 2:96062732-96062754 TTCCCAGGCCACTGTGGATCTGG + Intergenic
934724691 2:96608320-96608342 TGCCAAGGCCTCTGAGTTAGTGG - Intronic
934840000 2:97618814-97618836 TTCCCAGGCCACTGTGGATCTGG + Intergenic
934858349 2:97742847-97742869 TCCCAAGGCCAATATGTAAGAGG + Intergenic
935350381 2:102147439-102147461 TGCCAAGGCCACTATTGCACTGG - Intronic
938094840 2:128454909-128454931 TGCCTAAGCCACTGTGTCAGGGG - Intergenic
940340085 2:152571053-152571075 TTTCAAGGCTACTGTGGAACTGG - Intronic
940611529 2:155998564-155998586 TGCCAAGGCCAATGTCGAGAAGG - Intergenic
940896834 2:159089123-159089145 AGCCCAGCCCACTGTGGAAGGGG - Intronic
941168061 2:162104619-162104641 AGCCTTGTCCACTGTGGAAGGGG - Intergenic
941335326 2:164236603-164236625 TGCCCAGGCCACAGTGCAAATGG - Intergenic
942292406 2:174486345-174486367 TGGGAAGGCAGCTGTGGAAGTGG + Intronic
943987146 2:194637810-194637832 TGCCAAGGCCAATGTTGAGAGGG - Intergenic
945860757 2:215119375-215119397 TGCCAAGGCCAATGTTGAGAAGG + Intronic
946153745 2:217793728-217793750 AGCCAAGGCCACTGGGGCATGGG - Intergenic
946663181 2:222022468-222022490 TGCCAAGGCCAGTGTTGAGAAGG - Intergenic
947248616 2:228077401-228077423 TGGCAAAGCCACAGGGGAAGAGG + Intronic
947637165 2:231686014-231686036 TGCCAAGGCCAGTGCCAAAGAGG + Intergenic
948022193 2:234743793-234743815 TCAGAAGGCCACTGTGGAAGAGG - Intergenic
1172107230 20:32524027-32524049 TGCCCAGGCCACTTTGGAGTTGG - Intronic
1172148190 20:32772171-32772193 CGCCAAGGCCTCTGTGCAAGGGG - Intronic
1172175700 20:32970676-32970698 GGACAAGCCCACCGTGGAAGAGG - Intergenic
1172428898 20:34874497-34874519 TGCCAACTACACTGTGGGAGTGG - Intronic
1173321416 20:41990506-41990528 TCCCAAGGCCGCTGATGAAGGGG + Intergenic
1179501923 21:41815503-41815525 TGACGAGGCCCCTGTGGGAGGGG + Intronic
1179975521 21:44863510-44863532 TGCCCAGGTCATTGTGGATGGGG - Intronic
1180736509 22:18021764-18021786 TGCCAGGGCCACTGAGGGAGTGG - Intronic
1181527058 22:23496069-23496091 TGCCCAGGCCAGGGTGAAAGAGG - Intergenic
1182025614 22:27116075-27116097 TGCCAAAGTCAATGTGGAACAGG + Intergenic
1182264810 22:29106053-29106075 AGCCAAGGGCACTGTGGCAGTGG + Intronic
1183172290 22:36197295-36197317 TGCCATGGCAACTCTGTAAGGGG + Intronic
1183319403 22:37155931-37155953 TCCCATGGCCCCTGTGAAAGAGG - Intronic
1183320551 22:37162759-37162781 TGCCAGGGGTACTGGGGAAGAGG + Intronic
1183747624 22:39700690-39700712 TTCTAAGGCCACTGAAGAAGGGG + Intergenic
1184348687 22:43928847-43928869 GGATAAGGCCACTGTAGAAGGGG - Exonic
1184362638 22:44027371-44027393 GGCCCTGGCCAGTGTGGAAGAGG + Intronic
1184659748 22:45960366-45960388 TCCTAAGGCCACTGTGTCAGCGG + Intronic
950101417 3:10359094-10359116 TGCCCAGGCCACTCAGCAAGCGG + Intronic
950192066 3:10983976-10983998 TGCCAAGGCCATAGGGAAAGGGG + Intergenic
950429154 3:12940987-12941009 GGCCAAGGCCCCTGGGGGAGGGG + Intronic
951175700 3:19597012-19597034 TGCCAAAGCCAATGTTGAAGAGG + Intergenic
953921588 3:46955596-46955618 ATCCAAGGGCACTGGGGAAGTGG + Intronic
954292375 3:49656417-49656439 TGCCAAGGCCCCTGGGGCTGGGG + Exonic
954317620 3:49809869-49809891 TGCCGGGCCCACTGTGGAGGAGG + Exonic
955122404 3:56073661-56073683 TGCCAAGTCCAGAGTGGAAACGG - Intronic
955712587 3:61795827-61795849 TGCAAAGGCCACTTTGTAATGGG - Intronic
955881799 3:63554288-63554310 TGCCAAGGCCAATGTTGAGAAGG + Intronic
959476119 3:106814343-106814365 TGCCATGGCAACAGTGGAAGTGG + Intergenic
959947112 3:112136942-112136964 TGCTGAGGCCACTGAGGAAGGGG - Intergenic
960683925 3:120278245-120278267 TGCCAAGGCCAATGTTGATAAGG - Intronic
961142956 3:124570894-124570916 TGTCAAGGACATTGTGGAAGGGG - Intronic
962315670 3:134358095-134358117 TGCAAAGGCCAATGTGAAAGGGG + Intronic
962378908 3:134880995-134881017 TGCCAAGGTGAGTGTGGAAATGG - Intronic
963931596 3:151009404-151009426 TGCCAAGGCAGTTTTGGAAGGGG + Intergenic
964622799 3:158732934-158732956 TGGCACAGCCACTGTGGAGGTGG + Intronic
964897905 3:161620441-161620463 TGCCTAGGCCACTCTGAAATTGG + Intergenic
965120250 3:164545196-164545218 TGCCAAGGCCAATGTTGAGAAGG - Intergenic
965406691 3:168277720-168277742 TGGCAAGGCCATTGTGAATGGGG + Intergenic
965597375 3:170422059-170422081 TGCCCAGGGCACTGTGGGTGAGG + Intronic
966435764 3:179882369-179882391 TGCCCAGGACACTTTGGAGGGGG - Intronic
968482615 4:842929-842951 TGCTGAGGCCACTGTGGCATGGG - Intergenic
968520050 4:1031100-1031122 TGACCAGGCGACTGGGGAAGGGG - Intergenic
968546613 4:1202200-1202222 TGCAAGGGCCATCGTGGAAGAGG - Intronic
968704706 4:2072542-2072564 TGCCAGGGCCTCTGTGCCAGTGG + Intronic
969196280 4:5566322-5566344 TGCCTGGCCCAGTGTGGAAGAGG - Intronic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
969506048 4:7588431-7588453 TGCCAAGGCCACGTTGGAGGAGG + Intronic
969871492 4:10107625-10107647 TGTGGAGGCCACTGGGGAAGGGG - Intronic
970410950 4:15807441-15807463 AGACAAGGCCACTGTGTACGTGG - Intronic
971227879 4:24771649-24771671 CACCAATGCCACTGTGGAGGAGG + Intergenic
971739797 4:30504651-30504673 TGCCAAGGCCAATGTCGAGAAGG + Intergenic
971894900 4:32579791-32579813 TGCCAAGACCAATATGGGAGGGG - Intergenic
973725022 4:53766589-53766611 TTTCAAGGTCACTGTGGCAGAGG + Intronic
973742367 4:53930484-53930506 TCCCAAGGCCACAGGGGCAGAGG + Intronic
974950935 4:68582421-68582443 TGCAGGGGCCACGGTGGAAGTGG + Intronic
975103896 4:70546758-70546780 TGCCAAAGATACTGTGGAAAGGG - Intergenic
976853312 4:89574618-89574640 TGCCAAGCAGACTGAGGAAGAGG - Intergenic
977685378 4:99841579-99841601 TGCCAAGGCCAAGGTAGCAGTGG - Intronic
978083654 4:104623623-104623645 TCCCTAGGCCACATTGGAAGAGG + Intergenic
983134828 4:164067650-164067672 TGCCAAGGCCAATGTAAAAAAGG - Intronic
984751899 4:183286210-183286232 TGCCATGGCCACTATGGAGATGG + Intronic
985868422 5:2534567-2534589 CCCCAAGGCCACTGTGCCAGAGG - Intergenic
986283524 5:6343334-6343356 TACCAAAGGCACTGTGAAAGTGG - Intergenic
986608441 5:9545546-9545568 TGCCAAGGCCACGCAGGAATCGG + Intronic
988994997 5:36706294-36706316 GGACAAGGACACTGGGGAAGAGG - Intergenic
989384673 5:40843537-40843559 TGCAGAAGCCACTGTGGAAGAGG + Exonic
989455695 5:41640985-41641007 TGTCTAGGCATCTGTGGAAGGGG + Intergenic
989968426 5:50492155-50492177 TCCCAGTGCAACTGTGGAAGTGG - Intergenic
992286349 5:75239481-75239503 AGCCAGGGCCACTGTGTATGTGG - Intergenic
992667165 5:79021806-79021828 TGATAAGCCCACTGTGGAAAAGG + Intronic
997174372 5:131759171-131759193 TGCCAAGGCCAATGTCGAGAAGG - Intronic
997261356 5:132467722-132467744 TGCCAAGGCCACTGGTGCAAAGG - Intronic
999089815 5:148926366-148926388 TTCAAAGGGCACAGTGGAAGTGG - Intronic
1001207776 5:169780079-169780101 GGCCAAAGCCATGGTGGAAGGGG - Intronic
1002473516 5:179451483-179451505 TGCCAAGGACAGTCTGGGAGAGG + Intergenic
1002795015 6:465267-465289 TGCCATGGACACTGTGGGGGGGG + Intergenic
1004911026 6:20284094-20284116 TGCCAAGGCCAGTGTCGAGAAGG - Intergenic
1005141963 6:22642366-22642388 TTCCAAGGTCACTGTGGAAGAGG - Intergenic
1005769593 6:29053751-29053773 TGCCAAGGCCAATGTCCAAAAGG - Intergenic
1007081760 6:39110350-39110372 TGCCAATGGCCATGTGGAAGTGG + Intronic
1007155971 6:39744104-39744126 TGCCAAGCCCACTGTGTTTGAGG + Intergenic
1007314317 6:40973113-40973135 TGCCAAGGCCAATGTCCAAAAGG + Intergenic
1007319900 6:41020446-41020468 TGACTGGGTCACTGTGGAAGTGG + Intergenic
1007351654 6:41277852-41277874 TGGCAAAGCCATTGAGGAAGTGG - Intronic
1007790894 6:44307493-44307515 TGGCAAGGCCATTCTGGATGTGG - Exonic
1009803126 6:68568104-68568126 TGCCAAGGCCAATGTCCAAAAGG + Intergenic
1014852312 6:126357012-126357034 TGCCAAGGCCAATGTTGAGAAGG + Intergenic
1015260390 6:131230654-131230676 TGCCAAGGCCAATGTTGAGAAGG + Intronic
1020368763 7:7410348-7410370 TGCCAAGTCAATTGTGGCAGGGG - Intronic
1023856179 7:44185679-44185701 TGCCCAGGCCTCTGGGGATGAGG - Intronic
1024181078 7:46895756-46895778 TGCCAAGGCCAGTGTTGAGAGGG + Intergenic
1024354043 7:48396194-48396216 TCCCAAGGCCATGGTGGGAGGGG - Intronic
1024371050 7:48584397-48584419 TGCCAGGACCACTGTCGGAGAGG + Intronic
1024983340 7:55175525-55175547 AGCCCAGGCCAGTGTAGAAGAGG - Intronic
1026739064 7:72967108-72967130 GGCCTTGGCCACTGTGGAGGAGG + Intronic
1026790085 7:73325740-73325762 GGCCTTGGCCACTGTGGAGGAGG + Intronic
1027104669 7:75397965-75397987 GGCCTTGGCCACTGTGGAGGAGG - Intronic
1027766174 7:82345372-82345394 TGGCAATGCCACTGTAGAATGGG + Intronic
1028127120 7:87126154-87126176 TGGAAAGCCCACTGTGGAAAAGG + Intergenic
1028197129 7:87920236-87920258 TGCCATGGCCACTGTGGGGATGG - Intergenic
1028982427 7:96981468-96981490 TCTTAAGGCCTCTGTGGAAGGGG - Intergenic
1031734084 7:125334328-125334350 TGCCAATGCCTGAGTGGAAGAGG - Intergenic
1031771857 7:125853901-125853923 TGTCAAGGCCACTGGGGAGGGGG - Intergenic
1033454625 7:141491685-141491707 TGCCAAGGTCACATAGGAAGCGG + Intergenic
1033946676 7:146727212-146727234 TGCAAAGGACACTGTGTAACAGG - Intronic
1034132356 7:148731692-148731714 TGCCAGGGCCTCGGGGGAAGAGG - Intronic
1034540446 7:151754857-151754879 TCCGAAGGCCACTGTGGTATTGG + Intronic
1034996481 7:155580477-155580499 TGCCTGGGCCTCTTTGGAAGGGG - Intergenic
1035175137 7:157045053-157045075 CGCCAAGGCCACGGTTGAAGGGG - Intergenic
1035348555 7:158226362-158226384 TGGCTAGGTCACTGGGGAAGAGG + Intronic
1036213350 8:6860344-6860366 TGCTAGGGTCACTGTGAAAGCGG + Intergenic
1036754563 8:11463799-11463821 TGCAAAGGCCGCTGGGGAGGAGG + Intronic
1036927191 8:12918536-12918558 CTCCAAGGCCACTGTGGCAGGGG + Intergenic
1037136656 8:15470706-15470728 TGCCAAAGCCACTGTCTCAGTGG + Intronic
1038313840 8:26466143-26466165 TGCCAAGACCGCAGAGGAAGGGG + Intronic
1038415618 8:27393046-27393068 TTCCAAGGCAGCTGGGGAAGTGG + Intronic
1039950143 8:42164525-42164547 TGCCGAAGACACTGAGGAAGAGG + Intronic
1046575830 8:116027635-116027657 TGCAAAGGCCACTGTGGGTCTGG - Intergenic
1047290451 8:123524980-123525002 ATCCAAGGTCACTGTGGCAGAGG + Intronic
1047408108 8:124602080-124602102 TCCCTGGGCCACAGTGGAAGAGG + Intronic
1047702270 8:127461146-127461168 GGCCAAGGCCATGGTGGGAGGGG - Intergenic
1048940217 8:139394038-139394060 TCCCAAGCCCAGTGTGGCAGAGG + Intergenic
1048980537 8:139701616-139701638 TGCCAAGGCCAGTGTGTTAGTGG - Intronic
1049564784 8:143332354-143332376 TGCAAAGGCCTCAGTGGGAGAGG + Intronic
1049787585 8:144458468-144458490 TGCCCAGGAGACTGGGGAAGAGG + Intronic
1049806636 8:144543958-144543980 TTCCCAGGCCCCTCTGGAAGAGG + Intronic
1050179774 9:2908754-2908776 TGGCAATGACAGTGTGGAAGTGG - Intergenic
1052668344 9:31522990-31523012 TTCCTAGGTCAGTGTGGAAGAGG + Intergenic
1053310008 9:37011892-37011914 TGCAAATGACACTGTGTAAGAGG - Intronic
1055207209 9:73746766-73746788 TGCCAAGGCCAATGTTGAGAAGG + Intergenic
1055594152 9:77848566-77848588 GGCCAAGCCAACTCTGGAAGAGG - Intronic
1056444871 9:86656115-86656137 TGGCAATGCCACAGAGGAAGGGG - Intergenic
1057278104 9:93686920-93686942 AGCCAAGCCCACTGTGGTAGAGG - Intergenic
1057374738 9:94510350-94510372 TGCCCAGGCTACAGTGCAAGTGG + Intergenic
1058104752 9:100957122-100957144 TGCCAAGGGCAGTGTGAAACAGG - Intergenic
1058249535 9:102674386-102674408 TGCCAAGGCCAATGTTGAGAAGG + Intergenic
1059807491 9:117818640-117818662 TGCCAAGGCCTGTGTCGAAAAGG + Intergenic
1061360900 9:130141714-130141736 TGCCAAGGCAACTCGAGAAGGGG + Intergenic
1062228138 9:135465460-135465482 CGCCAAGGCCACGGTGGTGGTGG + Intergenic
1187700969 X:21963975-21963997 TGGCCAGCCCACTGTGGAGGTGG - Intronic
1188406310 X:29814649-29814671 TGCCAAGGCCAACGTTGAAAAGG + Intronic
1188790301 X:34401288-34401310 TGCCAAGGCCAGTGTTGAGAAGG - Intergenic
1189818078 X:44844285-44844307 TGTCAATGCCTCGGTGGAAGTGG + Exonic
1192710117 X:73573014-73573036 TGCCAAGGCCAATGTTGAGAAGG + Intronic
1192889683 X:75376472-75376494 TGCCAAGGCCAATGTTGAGAAGG + Intronic
1194268495 X:91781983-91782005 TGCCAAGGCGACTGAAGAACAGG - Intronic
1199016010 X:142816447-142816469 TGCCAAGTACACAGTGGATGTGG + Intergenic
1200585694 Y:5002896-5002918 TGCCAAGGCGACTGAAGAACAGG - Intronic
1200675819 Y:6145182-6145204 TGCCAAGGCCCGTGTTGAGGAGG - Intergenic