ID: 1147425817

View in Genome Browser
Species Human (GRCh38)
Location 17:40345424-40345446
Sequence GAGATCAGCAGGAAATCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 230}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147425817_1147425831 23 Left 1147425817 17:40345424-40345446 CCGGCTGATTTCCTGCTGATCTC 0: 1
1: 0
2: 1
3: 12
4: 230
Right 1147425831 17:40345470-40345492 CGAGCCTGCGAACGGCTCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1147425817_1147425828 20 Left 1147425817 17:40345424-40345446 CCGGCTGATTTCCTGCTGATCTC 0: 1
1: 0
2: 1
3: 12
4: 230
Right 1147425828 17:40345467-40345489 GTGCGAGCCTGCGAACGGCTCGG 0: 1
1: 0
2: 0
3: 1
4: 30
1147425817_1147425829 21 Left 1147425817 17:40345424-40345446 CCGGCTGATTTCCTGCTGATCTC 0: 1
1: 0
2: 1
3: 12
4: 230
Right 1147425829 17:40345468-40345490 TGCGAGCCTGCGAACGGCTCGGG 0: 1
1: 0
2: 1
3: 2
4: 30
1147425817_1147425834 29 Left 1147425817 17:40345424-40345446 CCGGCTGATTTCCTGCTGATCTC 0: 1
1: 0
2: 1
3: 12
4: 230
Right 1147425834 17:40345476-40345498 TGCGAACGGCTCGGGGGCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 27
1147425817_1147425835 30 Left 1147425817 17:40345424-40345446 CCGGCTGATTTCCTGCTGATCTC 0: 1
1: 0
2: 1
3: 12
4: 230
Right 1147425835 17:40345477-40345499 GCGAACGGCTCGGGGGCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 51
1147425817_1147425820 -9 Left 1147425817 17:40345424-40345446 CCGGCTGATTTCCTGCTGATCTC 0: 1
1: 0
2: 1
3: 12
4: 230
Right 1147425820 17:40345438-40345460 GCTGATCTCCTCCAGGAAACCGG 0: 1
1: 0
2: 3
3: 18
4: 163
1147425817_1147425830 22 Left 1147425817 17:40345424-40345446 CCGGCTGATTTCCTGCTGATCTC 0: 1
1: 0
2: 1
3: 12
4: 230
Right 1147425830 17:40345469-40345491 GCGAGCCTGCGAACGGCTCGGGG 0: 1
1: 0
2: 0
3: 0
4: 31
1147425817_1147425826 15 Left 1147425817 17:40345424-40345446 CCGGCTGATTTCCTGCTGATCTC 0: 1
1: 0
2: 1
3: 12
4: 230
Right 1147425826 17:40345462-40345484 CCCTTGTGCGAGCCTGCGAACGG 0: 1
1: 0
2: 0
3: 2
4: 49
1147425817_1147425833 28 Left 1147425817 17:40345424-40345446 CCGGCTGATTTCCTGCTGATCTC 0: 1
1: 0
2: 1
3: 12
4: 230
Right 1147425833 17:40345475-40345497 CTGCGAACGGCTCGGGGGCGTGG 0: 1
1: 0
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147425817 Original CRISPR GAGATCAGCAGGAAATCAGC CGG (reversed) Intronic
900227919 1:1541289-1541311 GGCCTCAGCAGGAAGTCAGCGGG + Intergenic
902797392 1:18808409-18808431 GAGATCAGCAAGGGGTCAGCTGG + Intergenic
903026211 1:20431219-20431241 GAGAGGAGCGGGAAATGAGCTGG - Intergenic
905913384 1:41669097-41669119 GAGATCAGCAGAAAATCCTGGGG - Intronic
907274285 1:53308647-53308669 CACATGAGCAGGGAATCAGCAGG - Intronic
907560482 1:55382932-55382954 GAGATCAGCAGCATACCTGCCGG - Intergenic
909766105 1:79358064-79358086 GATATCAGCAGGAAATAAATAGG - Intergenic
912890852 1:113528581-113528603 GAGATTAGCAGGAAATTGGTGGG + Intronic
913547845 1:119887049-119887071 GAGAGCAGCAAAAAATCTGCCGG - Intergenic
915011267 1:152688154-152688176 GAGAGAAGCAGGGAAACAGCAGG + Intergenic
915234226 1:154468786-154468808 GAGCTCAGCACCAAAGCAGCTGG - Exonic
915718523 1:157966377-157966399 GACCTCAGCAGTAAATCAGCAGG - Intergenic
915946861 1:160159098-160159120 GAGATAAGCCGGAGGTCAGCAGG - Exonic
919295012 1:195686788-195686810 GAATTCAGCTGGAAATTAGCTGG + Intergenic
919302901 1:195792208-195792230 GAGATGAGCATGACATCAGTAGG - Intergenic
921303534 1:213772847-213772869 GAGAACAGAAGGAAACCAGTTGG - Intergenic
921356521 1:214289573-214289595 GAGAAGAGCAGGAAATGAGAGGG - Intronic
922386049 1:225084236-225084258 GGGATAAGGAGGCAATCAGCTGG + Intronic
923394341 1:233545817-233545839 ACGATCACCAGGAAATAAGCTGG + Intergenic
923740818 1:236653612-236653634 AAGAGCAGCATAAAATCAGCAGG + Intergenic
1062792377 10:316667-316689 GAGGTGAGCAGGAAAGCCGCTGG - Intronic
1069639351 10:69944901-69944923 GAGGACAGCAGGAAGTCAGGAGG + Intronic
1069799282 10:71072240-71072262 GAGATCATGAGGACAGCAGCGGG + Intergenic
1069905260 10:71728502-71728524 GGGATTAGCTGGGAATCAGCTGG - Intronic
1070728641 10:78809428-78809450 GAGATTTGCAGCCAATCAGCTGG + Intergenic
1070946488 10:80396069-80396091 GACATCAGCAAGAGAACAGCAGG + Intergenic
1071337647 10:84613962-84613984 GTGTTGAGCAGGAAATCAGAAGG + Intergenic
1071815165 10:89225038-89225060 GATCTCAGGAGGAAATCTGCGGG + Intronic
1072293368 10:93987275-93987297 GAGATCCGAAGGACATCAGAAGG + Intergenic
1074413836 10:113249872-113249894 GAGGTCAGTAGGAAATGATCGGG - Intergenic
1074572995 10:114641783-114641805 GAGATCAGGAGGCAGACAGCAGG + Intronic
1077289100 11:1780648-1780670 GGGGTCAGCAGGAAATCACAAGG + Intergenic
1077849939 11:6066493-6066515 GAGATCAGAAAGAGATGAGCTGG - Intergenic
1079238138 11:18704081-18704103 GAGAGCAGGATGAAGTCAGCAGG + Exonic
1079446492 11:20561538-20561560 GAGATTAACAGGGAGTCAGCTGG - Intergenic
1079510901 11:21208936-21208958 GAGCTTAGCAGAGAATCAGCAGG + Intronic
1079867305 11:25752648-25752670 GATATCAGCAGGAGATTAGCAGG + Intergenic
1080039715 11:27746820-27746842 AAGATCAGAAGGAAGTCAGTGGG + Intergenic
1080866211 11:36197597-36197619 GAGATCAACAGCAGAGCAGCAGG - Intronic
1082031401 11:47606920-47606942 GAGAGCAGCAGGCACTGAGCTGG - Intergenic
1083007941 11:59366416-59366438 CAGATCATCTGGAGATCAGCTGG - Intergenic
1084554113 11:69865583-69865605 GAGATGGGCAGGTAAACAGCAGG - Intergenic
1086942982 11:92817138-92817160 GAGATAAGCAGGGCAGCAGCTGG + Intronic
1087923583 11:103894490-103894512 GAGAATAGCAAGAAACCAGCAGG - Intergenic
1089045655 11:115500851-115500873 GAGATGAGCAGGCAGTGAGCCGG + Intronic
1089563773 11:119359667-119359689 GAGATGACCAGGCAATCAGTGGG + Intronic
1089864208 11:121617584-121617606 GGGATGAGCAGGAACTGAGCGGG - Intronic
1091301011 11:134508300-134508322 CAGATCTGTAGGAAACCAGCTGG - Intergenic
1091549007 12:1523782-1523804 GAGGGCGGCAGGAACTCAGCAGG - Intergenic
1092337211 12:7643616-7643638 AATATCACCAGGAAATTAGCAGG + Intergenic
1095501422 12:42843821-42843843 GAGAACAGCTTGAAATCAGAAGG - Intergenic
1096062667 12:48715231-48715253 GACATCAGCAGGAAACAAACTGG + Intronic
1096616680 12:52837009-52837031 GACACCAGCAGGAGATCAGAGGG + Intergenic
1102786546 12:115609701-115609723 GAGAGAAGCAGGAAATGATCAGG - Intergenic
1103967686 12:124650645-124650667 GAGCTAAGCAAGACATCAGCAGG + Intergenic
1104157051 12:126143487-126143509 GAGATCGGCAGTAAAAAAGCTGG + Intergenic
1104313935 12:127679661-127679683 GGGATCAGCAGGAAAGGAGAGGG - Intergenic
1104554967 12:129791187-129791209 GACAAGAGGAGGAAATCAGCAGG + Intronic
1105404072 13:20119066-20119088 GGGACCAGCAGGGAAGCAGCTGG + Intergenic
1107693399 13:42975506-42975528 TAAATAAGCAGGAAATCATCGGG + Intronic
1109439735 13:62353348-62353370 GAGAGGAGCAGGAAACCACCTGG + Intergenic
1111298149 13:86310394-86310416 TAGATCATCAGGAATACAGCTGG + Intergenic
1111659829 13:91194959-91194981 GAGATCTGAAGGAAATCTGAAGG + Intergenic
1111993542 13:95139937-95139959 GAGGTCAGCATGGAATCAGTGGG - Intronic
1113014029 13:105807140-105807162 CAGATAAACAGGAGATCAGCTGG + Intergenic
1115718167 14:36128828-36128850 GAGCCCAGCAGGAGATCAGAGGG + Intergenic
1117760695 14:59025154-59025176 GAGACCAACAGGATTTCAGCTGG + Intergenic
1117811656 14:59553243-59553265 GAGATCAGCTGTTAATCTGCTGG - Intronic
1119193078 14:72697450-72697472 GACATGAGCAGGACTTCAGCAGG + Intronic
1119797676 14:77413957-77413979 GAGATCCGCAGGCTTTCAGCAGG + Exonic
1120048069 14:79831073-79831095 GAGACCACCAGGAAATCATAAGG + Intronic
1121454323 14:94028571-94028593 GACATAAGCAGGAAAACCGCAGG + Intronic
1122468603 14:101950774-101950796 GAGAACAGCAAGAAAGCTGCTGG - Intergenic
1124372143 15:29110064-29110086 GGGCTCTGCAGAAAATCAGCTGG + Intronic
1124478633 15:30058778-30058800 GAGATCATCAGGAAAACACTCGG + Intergenic
1125821465 15:42635703-42635725 GAGATAAGTAGAAATTCAGCAGG - Intronic
1125888987 15:43251769-43251791 GAGATGAGGAGGAAATCATGAGG - Intronic
1128931965 15:71713323-71713345 GAGCTCATTAGGAAAACAGCAGG - Intronic
1129098369 15:73233769-73233791 GATTTCAGTAGGAAAGCAGCTGG - Intronic
1130322096 15:82850067-82850089 GACATCAGAAGGGAAGCAGCAGG + Intronic
1130923249 15:88366552-88366574 CAGATCAGCAGGACATGGGCGGG + Intergenic
1131299467 15:91183793-91183815 GTGATTAGCAGGAAAACAGAGGG + Intronic
1132245804 15:100295336-100295358 GAGCTCAGCAGGAAGCCAGCTGG - Intronic
1134334427 16:13284531-13284553 GAGCTGACCAGGTAATCAGCAGG - Intergenic
1137229364 16:46549023-46549045 GAGAAGAGCAGCAGATCAGCAGG - Intergenic
1139217346 16:65139683-65139705 GAGCTCAGCAGTAATTCAGATGG + Intergenic
1139341409 16:66270279-66270301 GAGATCAGAGGGATCTCAGCCGG + Intergenic
1141852168 16:86653883-86653905 GGGACCAGGAGGAAACCAGCAGG - Intergenic
1144389655 17:14781339-14781361 GAGATAGGCAGGAGACCAGCTGG - Intergenic
1144584304 17:16478723-16478745 CAGACCAGCAGGAACTCAGAGGG - Intronic
1145973665 17:28971920-28971942 GAAATCAGCAGGAGATGAGTTGG - Intronic
1146512590 17:33462955-33462977 GAGATCCGCAGGAAGTAAGTGGG - Intronic
1146653492 17:34621656-34621678 GTCATCAGCAGGAAGGCAGCAGG + Intronic
1147425817 17:40345424-40345446 GAGATCAGCAGGAAATCAGCCGG - Intronic
1149491726 17:57089985-57090007 GAGATCTGTAGGAAGTCATCAGG - Intronic
1150638290 17:66931913-66931935 GAGAACAGCATGAACTCAGGAGG + Intergenic
1152936919 17:83144528-83144550 CAGCTCAGCAGGAAGGCAGCGGG + Intergenic
1153925574 18:9832289-9832311 GGGTTCAGAAGGAAATGAGCAGG + Intronic
1155415313 18:25592458-25592480 TAGATAAGCTGGAAATTAGCTGG + Intergenic
1156050951 18:32933400-32933422 GAGAAAAGCAGGAAAGCACCAGG - Intergenic
1157857120 18:51113459-51113481 GAGAACAGCAGCTAAGCAGCTGG - Intergenic
1160475509 18:79182163-79182185 GACATCAGCAGGATCCCAGCAGG - Intronic
1161302353 19:3548765-3548787 GAGCACAGCAGGAGGTCAGCTGG + Intronic
1161424071 19:4192632-4192654 GAGATCAAGAGGAAACAAGCTGG + Intronic
1161641254 19:5424749-5424771 GAGCTAATCAGGAAGTCAGCAGG - Intergenic
1163463493 19:17453372-17453394 GAGGTGAGCATGAAATCAGGTGG + Intronic
1163683677 19:18698163-18698185 GCGCTCAGCAGGCACTCAGCAGG + Intronic
1164656079 19:29922977-29922999 AAGATAAGGACGAAATCAGCAGG + Intergenic
1164875057 19:31678880-31678902 GAGAACAGCAGGGCAGCAGCAGG + Intergenic
1165077317 19:33287072-33287094 GGCACCAGCAGGAAATCAGACGG - Intergenic
1165757015 19:38299523-38299545 GAGATCATCAGGGAATAAACAGG + Intronic
1165939669 19:39408717-39408739 CAGATCAGCTGGATCTCAGCGGG + Exonic
1166246493 19:41530835-41530857 GAAATAAGCAGAACATCAGCTGG - Intergenic
1166246522 19:41531160-41531182 GAAATAAGCAGAACATCAGCTGG - Intergenic
1166308732 19:41950284-41950306 GAGAACAGCATGAAACCAGGAGG + Intergenic
1168342699 19:55634934-55634956 GAGAGCAGCAGGAAAGCACTCGG - Intergenic
1168439175 19:56348710-56348732 AATATCACCAGGAAATTAGCAGG + Intronic
927998888 2:27506247-27506269 GAGTGCAGCAGGAAAGCACCAGG - Intronic
928795522 2:35014212-35014234 GAGATCAGCAGTAAGTCTGATGG - Intergenic
929290784 2:40188718-40188740 AAGAACACCAGGAAATGAGCTGG + Intronic
929576960 2:43057974-43057996 GAGAGCAGCAGGAGTTCACCTGG - Intergenic
930621505 2:53648714-53648736 GAGAACAGCTGGAACTCAGGAGG + Intronic
936062630 2:109305478-109305500 GAGACCAGAAGGAAACTAGCAGG - Intronic
937479234 2:122241736-122241758 GAGACCTGCAGGAAAGCATCTGG - Intergenic
937827232 2:126380235-126380257 GAGATCAGCAGCAATCCAGCTGG + Intergenic
939143820 2:138388979-138389001 GAGATGAGTAAGAAATCAGTAGG - Intergenic
939541030 2:143493712-143493734 GAGATCACAGGGCAATCAGCTGG - Intronic
940083169 2:149827892-149827914 GAGATAAGGAGGAAATTGGCTGG - Intergenic
942823887 2:180150283-180150305 TACATAAGCAGGTAATCAGCAGG + Intergenic
943257226 2:185611295-185611317 GACAGCAGCAGCAAAACAGCTGG + Intergenic
944820903 2:203429832-203429854 GCGGTCAGCAGGAATGCAGCTGG + Exonic
946130596 2:217603721-217603743 GAGCCCAGCAGGAGATCAGAAGG - Intronic
948750762 2:240131501-240131523 GAGAGCAGAGGGAAACCAGCCGG + Intronic
1168779137 20:473808-473830 GAGATCAGAAGACAATCAACTGG - Intronic
1168984005 20:2032068-2032090 GTGAGCAGCAGGGAAACAGCAGG - Intergenic
1177282408 21:18998864-18998886 GAGACCAGGAGTAAACCAGCTGG + Intergenic
1178302697 21:31466227-31466249 GAGATCAGTAGCCAATGAGCCGG + Intronic
1178425474 21:32475773-32475795 GAAGTCAGCTGGAAGTCAGCCGG - Intronic
1179609283 21:42539413-42539435 GAGAACAGCATGAAAGCATCCGG + Intronic
1180974778 22:19842370-19842392 GAGATCAGCGGGGAGTCAGTGGG + Intronic
1181681193 22:24496851-24496873 GAGGACAGCAGGAAGTCTGCTGG + Intronic
1182022172 22:27090494-27090516 GAGAGCAGCTGGGCATCAGCTGG - Intergenic
1182294566 22:29305480-29305502 GAAATCAACAGCAAAACAGCAGG - Intergenic
1184522150 22:45001116-45001138 GAGACCAGCTGGAGATGAGCAGG + Intronic
950172706 3:10850691-10850713 GAGATCAGAAGGGAAGCGGCGGG + Intronic
950455551 3:13090827-13090849 GAGCTCAGAAGGACCTCAGCCGG + Intergenic
951253658 3:20423969-20423991 GAAAACAGAATGAAATCAGCAGG + Intergenic
951689486 3:25380778-25380800 GAGAAGAGGAGGAAATTAGCAGG - Intronic
953461807 3:43087479-43087501 GAGACCAGCAGGTCACCAGCAGG + Intronic
955343423 3:58143185-58143207 GAGAACACCATGAAACCAGCTGG - Intronic
956601158 3:71024040-71024062 GAAATCAGCTGGAAATCAGCTGG + Intronic
958178202 3:90023565-90023587 GACACCAGCAGAAAATCAGAGGG + Intergenic
958420207 3:93921178-93921200 GTTAACATCAGGAAATCAGCTGG - Intronic
959088999 3:101882204-101882226 AAGATAAGTAGGAATTCAGCAGG - Intergenic
960157178 3:114307928-114307950 GACCTCAGGAGAAAATCAGCTGG + Exonic
960482814 3:118213970-118213992 GTGATAAGCTGGAAGTCAGCAGG + Intergenic
961618658 3:128205539-128205561 GAGATCAGCAGACAATTTGCTGG - Intronic
961820175 3:129571850-129571872 GGGAGCAGCAGGTTATCAGCAGG + Intronic
962092501 3:132259803-132259825 GAAGTCAGCAGGAAAGTAGCTGG - Intronic
963254425 3:143130711-143130733 GAGAAAATCAGGAAATTAGCTGG + Intergenic
963831571 3:150014707-150014729 GAGAACACCAGGAAAGCAACAGG + Intronic
963991869 3:151665568-151665590 GAGAACAGCAGCATAACAGCTGG - Intergenic
966110923 3:176400450-176400472 AAGATCACCAAAAAATCAGCTGG - Intergenic
967070526 3:185958747-185958769 GTGAGCAGCAGGAAATAAGACGG - Intergenic
967903852 3:194485895-194485917 GGGATTGGCAGGAACTCAGCTGG - Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
969129625 4:4981987-4982009 GACATCAGCAGGAGATCTGAGGG + Intergenic
969249010 4:5955030-5955052 GAGCTCAGGAGGAAGACAGCAGG - Intronic
969432401 4:7163104-7163126 GAGATGATCAGGAAACCAGGTGG + Intergenic
969526589 4:7706941-7706963 GTGGTGAGCAGGAAAGCAGCAGG - Intronic
969926208 4:10587941-10587963 GAAATTAGCAGTAAATCAGCTGG + Intronic
971036954 4:22704145-22704167 TAGAACAGAAGGAAAACAGCAGG - Intergenic
973317627 4:48779291-48779313 GAGAGCAGCAGGCAATCTACAGG + Intronic
973749502 4:53999456-53999478 GAGATGTGCATAAAATCAGCTGG - Intronic
973981965 4:56314887-56314909 GAGAGCAGCAGGGAAGGAGCGGG + Exonic
975448891 4:74501118-74501140 GAGATCAGCTTGGAATCAGGAGG - Intergenic
976209767 4:82655949-82655971 CAAATCAGCAGAACATCAGCTGG + Intronic
980486393 4:133462430-133462452 GAGCTCAACAGGAAACCAGAGGG - Intergenic
984243818 4:177250317-177250339 GAGATTGGCAGGAACTCAGCGGG - Intergenic
985320890 4:188709635-188709657 GAGAACAGGAGGAAAGAAGCTGG + Intergenic
985339108 4:188929709-188929731 GAGATCAACAGAAGATCAGAAGG + Intergenic
987214751 5:15722565-15722587 CATATGAGCAGGAAATGAGCCGG - Intronic
990142280 5:52719523-52719545 GAGATCAGCAGTTAATCTGATGG - Intergenic
990718367 5:58664848-58664870 GAGAATAGTAGGAAATGAGCTGG - Intronic
992284122 5:75215114-75215136 AAGGCCAGCAGGAAATCATCCGG + Intronic
994013966 5:94943369-94943391 GTGATCAGCAAGAAACCAGTGGG + Intronic
996422989 5:123282651-123282673 GAGAACAGCATGGAATCAGCTGG - Intergenic
997300177 5:132797980-132798002 GAGAGCAGGAGGAATTCAGGAGG + Intronic
998578921 5:143349608-143349630 GAAAGCTGCAGGAAAGCAGCAGG - Intronic
999372654 5:151065139-151065161 GACAACAGCAGCATATCAGCAGG + Intronic
1001622360 5:173098414-173098436 GAAATCAGAAGGAAATCAGAAGG - Intronic
1005287275 6:24341464-24341486 GATTTCAGCAGGAAATATGCAGG - Intronic
1005367064 6:25089275-25089297 CAGATCAGCCGGAGCTCAGCAGG + Intergenic
1005378137 6:25206315-25206337 AAGATCAGCTTGAGATCAGCTGG + Intergenic
1007698581 6:43749880-43749902 GAGATCTGAAGGAAATGAGGGGG - Intergenic
1007957909 6:45933928-45933950 CAGAGCAGCAGGAAGTCAGCAGG + Intronic
1013073973 6:106754323-106754345 GAGATAAGCAGGAACTGAGGAGG + Intergenic
1014042119 6:116840333-116840355 GAGATCATCAGGGGATAAGCTGG - Intergenic
1015438461 6:133218788-133218810 GAGAGCAGCAGGAAAAGAACTGG - Intergenic
1018762962 6:166906857-166906879 GACATCAGCAGGTAATGAACAGG - Intronic
1019080603 6:169427029-169427051 CAGATGAGGAAGAAATCAGCAGG + Intergenic
1020368872 7:7411552-7411574 GAGATGAGCAGGAAAGGATCAGG - Intronic
1022225012 7:28354010-28354032 GAGATAAGCAGGAAGTCATTTGG + Intronic
1022510669 7:30933190-30933212 CAGAGCTGCAGGATATCAGCTGG - Intergenic
1023059797 7:36316169-36316191 GAGAGCAGCAGGAAAAGAGATGG + Intergenic
1023380771 7:39605663-39605685 GAGATCTGCAGGCAATGAGCTGG - Intronic
1028958990 7:96727740-96727762 GAGAGCAACAGGAAATGGGCAGG - Intergenic
1029200619 7:98836887-98836909 GAAATAAGCAGAAAATAAGCTGG - Intergenic
1029986984 7:104931381-104931403 AAGGTCACCAGGAAATCAGGAGG - Intergenic
1030857385 7:114577624-114577646 GAGATCAGGAGGAAGTCTGGTGG - Intronic
1032559386 7:132872890-132872912 GAGGTCAGCTCGACATCAGCCGG + Intronic
1035749658 8:1987614-1987636 GAGAGGAGCAGGAGAGCAGCCGG - Intronic
1037644035 8:20773974-20773996 GAGCTCAGCTAGGAATCAGCAGG - Intergenic
1038269749 8:26065564-26065586 GAGAGCAACAAGAAATGAGCTGG - Intergenic
1038633056 8:29263422-29263444 AAGATTGGCAGGAAATGAGCAGG - Intergenic
1039002009 8:32991780-32991802 GAAATCAGCAGTGAATCAACTGG + Intergenic
1039267567 8:35842018-35842040 GACACCAGCAGGGAACCAGCAGG + Intergenic
1039745903 8:40426397-40426419 GAAATCGACATGAAATCAGCTGG + Intergenic
1040310897 8:46236317-46236339 GAGTGCAGCAGGGACTCAGCAGG + Intergenic
1040698832 8:50036534-50036556 GAGATGAACAAGAAAACAGCTGG - Intronic
1045109437 8:98926206-98926228 GAGAGCAGCTGGAACTCTGCAGG + Intronic
1046581736 8:116101695-116101717 GACATGAGGAGGAAATGAGCCGG - Intergenic
1047762677 8:127965782-127965804 GAGATTGGCAGGAGATGAGCAGG + Intergenic
1048223668 8:132565384-132565406 GAAATCAGAAGGAAATCCGAAGG + Intergenic
1049276841 8:141724249-141724271 GAGAGCAGCAGGAGCACAGCGGG + Intergenic
1049552928 8:143268931-143268953 GAGAACAGCTTGAAATCAGGAGG - Intronic
1051235550 9:14994682-14994704 GAAATCAGCTGGAAATCAGTAGG + Intergenic
1054914077 9:70479916-70479938 GAGACCAGCAGGAGGTGAGCAGG - Intergenic
1055102250 9:72478179-72478201 GAGAGCAGCAGGAAAGCTGAGGG - Intergenic
1057953847 9:99391566-99391588 GAGAGAAGCAGGAAATAAGTTGG - Intergenic
1058402669 9:104636228-104636250 GGGATCAGCTGGAAACCAGGAGG + Intergenic
1060188690 9:121578881-121578903 GAGATCAGAAGGACATGGGCTGG - Intronic
1060439798 9:123627821-123627843 GAGGCCAGCAGGAAACCAGAGGG + Intronic
1060458436 9:123823744-123823766 GGGAGCAGAAGGAAGTCAGCCGG + Intronic
1060692864 9:125679823-125679845 GAGATCAGAGGGAAGTGAGCGGG - Intronic
1187179968 X:16934804-16934826 GACATGAGCAGGAAATAAACCGG + Intergenic
1191035348 X:56020183-56020205 GAAATCAGCATGTATTCAGCTGG + Intergenic
1191668294 X:63725455-63725477 GTGATGAGCTGGAGATCAGCTGG + Intronic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1192446735 X:71216570-71216592 GAGAGCAACAGGAAGTCAGGTGG + Intronic
1193560380 X:83010531-83010553 AATATCATCAGGAAATTAGCAGG - Intergenic
1197199995 X:123740408-123740430 GGTATCAGCAGGAGATCAGATGG - Intergenic
1197783621 X:130179534-130179556 GAGGTCAGTAGGAAGACAGCAGG - Intronic
1197867255 X:131032493-131032515 GAGATCAGTAGGCAGACAGCTGG - Intergenic