ID: 1147427962

View in Genome Browser
Species Human (GRCh38)
Location 17:40355267-40355289
Sequence GGTCCGGCTGCTCCAGGTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 349}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147427962_1147427970 7 Left 1147427962 17:40355267-40355289 CCAGGACCTGGAGCAGCCGGACC 0: 1
1: 0
2: 1
3: 29
4: 349
Right 1147427970 17:40355297-40355319 CATGCTGCAGGAGCCGCTGCTGG 0: 1
1: 1
2: 2
3: 37
4: 366
1147427962_1147427971 10 Left 1147427962 17:40355267-40355289 CCAGGACCTGGAGCAGCCGGACC 0: 1
1: 0
2: 1
3: 29
4: 349
Right 1147427971 17:40355300-40355322 GCTGCAGGAGCCGCTGCTGGAGG 0: 1
1: 1
2: 7
3: 97
4: 691
1147427962_1147427974 30 Left 1147427962 17:40355267-40355289 CCAGGACCTGGAGCAGCCGGACC 0: 1
1: 0
2: 1
3: 29
4: 349
Right 1147427974 17:40355320-40355342 AGGCGCTAAAGGTCTACGTGCGG 0: 1
1: 0
2: 1
3: 3
4: 23
1147427962_1147427972 19 Left 1147427962 17:40355267-40355289 CCAGGACCTGGAGCAGCCGGACC 0: 1
1: 0
2: 1
3: 29
4: 349
Right 1147427972 17:40355309-40355331 GCCGCTGCTGGAGGCGCTAAAGG 0: 1
1: 0
2: 0
3: 6
4: 104
1147427962_1147427968 -5 Left 1147427962 17:40355267-40355289 CCAGGACCTGGAGCAGCCGGACC 0: 1
1: 0
2: 1
3: 29
4: 349
Right 1147427968 17:40355285-40355307 GGACCGGGTGGACATGCTGCAGG 0: 1
1: 0
2: 1
3: 18
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147427962 Original CRISPR GGTCCGGCTGCTCCAGGTCC TGG (reversed) Exonic
900113289 1:1018590-1018612 CGGCCGGCTGCTCCAAGTGCGGG + Intergenic
900129619 1:1081866-1081888 GTTCCCGCTGGCCCAGGTCCCGG + Exonic
900176571 1:1293869-1293891 GGTCCCGCTGCTCTTGGTCCAGG + Exonic
900355471 1:2260142-2260164 GTTCCTGCTGCTCCACGTCCTGG + Intronic
901012018 1:6207421-6207443 GGACCGGCTGCTGCAGTTCCTGG + Exonic
901688001 1:10954989-10955011 GGCCGGGGTGCTCCAGGTCCAGG - Exonic
901801056 1:11708194-11708216 GCTCCGGCTCCGCCAGCTCCAGG + Intronic
903662526 1:24987081-24987103 TGTCAGGCTGGTCCAAGTCCAGG - Intergenic
903919241 1:26787889-26787911 GGCGGGGCTGCTCCAAGTCCGGG + Intronic
903969748 1:27110926-27110948 ATTCCTCCTGCTCCAGGTCCTGG - Intronic
904403846 1:30273720-30273742 GGGCAGGCAGCTCCAGGTGCTGG + Intergenic
904492635 1:30870307-30870329 GGTCTGGGCTCTCCAGGTCCTGG + Intronic
904551879 1:31325530-31325552 GGGCAGGCAGCTCCAGGTGCTGG - Intronic
905183104 1:36178534-36178556 GCTCCCGCTGCTCCCGGGCCTGG - Exonic
905742876 1:40387934-40387956 TGGCCGGCTGCTCCAAGTGCGGG - Intronic
906563525 1:46778784-46778806 GGGCCGGCTGCTCCCAGTGCGGG + Intronic
907320120 1:53596709-53596731 GCTCGGGCTGCTCCAGTTGCAGG - Intronic
907388299 1:54139945-54139967 TGTTGGGCTCCTCCAGGTCCAGG + Exonic
908027770 1:59969943-59969965 CGGCCGGCTGCTCCAAGTGCGGG + Intergenic
908260551 1:62336796-62336818 GGCCCGGCTCCTCCAGGTGTAGG - Intergenic
909282421 1:73771586-73771608 GGGCAGGCAGCTCCAGGTGCTGG - Intergenic
911475322 1:98366569-98366591 GGGCAGGCAGCTCCAGGTGCAGG + Intergenic
914806945 1:150998649-150998671 GGTCCGCATGCTCAGGGTCCGGG - Intronic
914857371 1:151362588-151362610 ATTCCAGCTGCTCCAGCTCCAGG + Intergenic
915102604 1:153511176-153511198 GGTCAGGCTGCCCCGGGCCCTGG - Intergenic
915356000 1:155255439-155255461 GCTCCGGCTGCCGCAGGTCGGGG + Intronic
916510534 1:165469057-165469079 GGTCCGGCTGTTCCAAAGCCAGG + Intergenic
917817601 1:178725838-178725860 GGCCCGGCTTCTGCTGGTCCTGG - Intronic
919092835 1:192994706-192994728 GCTCCGGCTGCTCCAGCCCCAGG - Intergenic
919168655 1:193927201-193927223 GGGCAGGCAGCTCCAGGTGCTGG + Intergenic
919174455 1:194001923-194001945 CGGCCGGCTGCTCCAAGTGCAGG - Intergenic
919825252 1:201498941-201498963 AGTGCGGCTGCTCCAGAACCTGG - Intronic
920299381 1:204978984-204979006 GGTCGGTCAGCTCCAGGTCCCGG - Exonic
920301509 1:204991867-204991889 GGGCCAGGTGCTCCAGTTCCTGG + Intronic
922041570 1:221903187-221903209 GGGCAGGCAGCTCCAGGTGCCGG + Intergenic
923051264 1:230392881-230392903 GCTCCTGCTGCTCCAGGCTCTGG - Intronic
923786077 1:237070740-237070762 GGGTGGGCTGCTCCAGGTGCTGG + Intronic
1063381263 10:5587684-5587706 GGTGGGGCTGCTCCAGGACCAGG + Intergenic
1064449226 10:15426354-15426376 GGGCCGGCCGCTCCAAGTGCGGG + Intergenic
1065892452 10:30132769-30132791 GCCCTGTCTGCTCCAGGTCCAGG + Intergenic
1066235481 10:33480743-33480765 GGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1067451212 10:46383200-46383222 AGACAGGCTGCTCCATGTCCTGG - Intronic
1067586030 10:47476551-47476573 AGACAGGCTGCTCCATGTCCTGG + Intronic
1067852445 10:49762271-49762293 GGTCCGGAGGCTGCAGGTCAGGG + Exonic
1068819233 10:61353750-61353772 GGTAAGGATGCTACAGGTCCTGG - Intergenic
1069896924 10:71685688-71685710 TCTCCGGCTGCCCCAGGGCCAGG - Intronic
1070287530 10:75094711-75094733 CCTCCGGCAGCTCCAGGTTCTGG - Exonic
1070720320 10:78752465-78752487 GGCCCGGCTCCTCCTGGTCATGG - Intergenic
1070866645 10:79711327-79711349 CTTCCTCCTGCTCCAGGTCCTGG - Exonic
1070880434 10:79849448-79849470 CTTCCTCCTGCTCCAGGTCCTGG - Exonic
1071451459 10:85795293-85795315 GGTCTGGCTGCCCCAGGAACAGG - Intronic
1071957200 10:90771626-90771648 GGGCAGGCAGCTCCAGGTGCTGG - Intronic
1072729080 10:97832680-97832702 AGCCGGGCTGCTCCAGGCCCAGG + Intergenic
1073292909 10:102422074-102422096 GATCCAGCTCCTCCAGGGCCGGG - Exonic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1075255603 10:120923906-120923928 CGGCCGGCTGCTCCAAGTGCGGG - Intergenic
1076387776 10:130070325-130070347 GGACAGGCTGCACCAGGTCCGGG - Intergenic
1076507864 10:130989887-130989909 GGTTCGGCTGGTCCAGACCCTGG - Intergenic
1076779185 10:132714582-132714604 GGGCCGGCAGCACCAGGCCCAGG + Intronic
1077262214 11:1628841-1628863 TGCCCGCCTGCTCCGGGTCCCGG - Intergenic
1080195213 11:29600425-29600447 TGGCCGGCTGCTCCAAGTGCGGG + Intergenic
1081237268 11:40660172-40660194 GGGCAGGCAGCTCCAGGTGCTGG - Intronic
1081691839 11:45083585-45083607 GTCCCGGCTGCTCCAGGCTCTGG - Intergenic
1082001946 11:47398074-47398096 TGTCCTGCTTCTCCTGGTCCAGG + Intergenic
1083456444 11:62782127-62782149 GGTGCAGTTGCTCCAGGTCATGG - Exonic
1083669763 11:64293090-64293112 CGTGGGGCTGCTCCAGGGCCCGG - Exonic
1084415879 11:69032754-69032776 GGTCCCCCTGCTCCTGTTCCCGG - Intergenic
1086001625 11:81991157-81991179 CGGCCGGCTGCTCCAAGTGCGGG + Intergenic
1086731723 11:90258003-90258025 GGTCTTGTTACTCCAGGTCCTGG - Intergenic
1086850341 11:91800297-91800319 GGGCAGGCAGCTCCAGGTGCTGG - Intergenic
1087385271 11:97462069-97462091 GGGCAGGCTGCTCTAGGTGCTGG - Intergenic
1087391284 11:97537869-97537891 GGACAGGCTGCTCCAGGTGCTGG - Intergenic
1087904546 11:103680463-103680485 GGTCAGGCTGCCCCAGAGCCTGG + Intergenic
1089518473 11:119048523-119048545 GTTCCTGCTTCTCCAGGTCTCGG + Exonic
1089560344 11:119340361-119340383 CGTCCTGCTGCTCCTGGGCCTGG - Exonic
1089565105 11:119367016-119367038 GGTCCGACTGCTGCAGGACACGG + Intronic
1089587091 11:119516839-119516861 GGTCGGGCAGCCACAGGTCCTGG - Intergenic
1090514514 11:127411451-127411473 GGTCAGGCAGCTCCAGGTGCTGG + Intergenic
1091683110 12:2540878-2540900 GCTCCTGCTGTTCCAGCTCCTGG - Intronic
1092263327 12:6963652-6963674 GGTCAGGCAGCTTCAGGCCCAGG - Intergenic
1092272911 12:7037506-7037528 TGGCCGGCTGCTCCAAGTGCCGG - Intronic
1093289191 12:17300874-17300896 GGTCAGGCAGCTCCAGGGCTGGG - Intergenic
1094108768 12:26839257-26839279 TGGCCGGCTGCTCCGGGTGCGGG - Intergenic
1094722046 12:33075427-33075449 CGTCCGGCTGCTCCGAGTGCGGG - Intergenic
1096080155 12:48827743-48827765 GGTGAGGCTGGTACAGGTCCTGG - Exonic
1096472742 12:51889415-51889437 GGTCCCGGCGTTCCAGGTCCAGG - Exonic
1096612022 12:52808398-52808420 GGTCCAGCAGCTCCAGATCTCGG - Exonic
1096676183 12:53227386-53227408 GGTCAGGCTGGCCCAGGCCCCGG + Exonic
1097129837 12:56803960-56803982 GGCCGGGCAGCTCCAGGTGCTGG + Intergenic
1097189292 12:57211847-57211869 GGTCCCCCTGCTCTAGGTCCCGG - Intronic
1097461765 12:59871680-59871702 GGACCAGCTGCCCCAGGCCCAGG + Intergenic
1099190942 12:79561621-79561643 TGGCCGGCTGCTCCAGGTGCGGG - Intergenic
1102098483 12:110258938-110258960 TGAACGGCTGCTTCAGGTCCTGG - Intergenic
1102899404 12:116624741-116624763 CCTCCAGCTGCTCCAGCTCCCGG - Intergenic
1103972357 12:124680032-124680054 GCTCCGGGTGCCCCAGGCCCTGG - Intergenic
1104198740 12:126567133-126567155 GGGCCGGCTGCTCCAAGTGCAGG - Intergenic
1104614535 12:130256933-130256955 TGGCCGGCTGCTCCGGGTGCGGG + Intergenic
1104719285 12:131036064-131036086 GGTGAGGCTGCTCCTGTTCCTGG + Intronic
1105837719 13:24225283-24225305 GGGCAGGCAGCTCCAGGTGCCGG + Intronic
1106340273 13:28820353-28820375 GCGCCGGCGGCTCCAGGTGCGGG + Exonic
1107650205 13:42537088-42537110 AGTCTGGCTCCTCCAGGTGCTGG + Intergenic
1108240212 13:48456760-48456782 GGGCGGGCAGCTCCAGGTGCTGG + Intronic
1108615442 13:52128304-52128326 GGCCACGCTGCTCCTGGTCCCGG + Intronic
1109468252 13:62767749-62767771 GGGCAGGCAGCTCCAGGTGCTGG + Intergenic
1109780880 13:67108018-67108040 GGACGGGCAGCTCCAGGTGCTGG - Intronic
1110940315 13:81341049-81341071 GGGCCGGCTGCTCCGGGTGCGGG + Intergenic
1113580030 13:111422024-111422046 GGTCCATGTGCTCCAGGTCTGGG - Intergenic
1113813874 13:113158672-113158694 CGTCCCACTGCTCCAGGGCCTGG + Exonic
1115059207 14:29169509-29169531 GGACAGGCAGCTCCAGGTGCTGG - Intergenic
1118306318 14:64658261-64658283 GGGCCGGCGGCTCCAAGTGCGGG - Intergenic
1118864610 14:69693209-69693231 TATCCTGCTGCTCCAGGTACAGG - Intronic
1118912010 14:70069478-70069500 GGTCCAGCTGCCCCAGGTCAAGG - Intronic
1119406926 14:74404860-74404882 TTTCCAGCTGCTGCAGGTCCTGG + Intergenic
1119473184 14:74911820-74911842 GGTGCAGCTGGTCCAGGACCCGG - Exonic
1119718466 14:76875080-76875102 GGTGAGGCTGCCCCAGGCCCGGG + Intergenic
1120213574 14:81658436-81658458 GGACTGTATGCTCCAGGTCCTGG - Intergenic
1121485934 14:94314369-94314391 GGCCCAGCTTCTCCAGGGCCTGG - Exonic
1121605112 14:95234701-95234723 GGTGCGGCTGAGCCAGGGCCAGG - Intronic
1122292865 14:100688785-100688807 GCCCCGGCTGCTCCAGGTTGGGG + Intergenic
1123735621 15:23180126-23180148 GGCCCGGCAGCTGCAGGTGCGGG + Intergenic
1123799123 15:23802995-23803017 CGGCCGGCTGCTCCAAGTGCGGG - Intergenic
1123851512 15:24361986-24362008 GCCCCAGCTGCTCCAGCTCCAGG - Intergenic
1124286337 15:28403109-28403131 GGCCCGGCAGCTGCAGGTGCGGG + Intergenic
1124296366 15:28508527-28508549 GGCCCGGCAGCTGCAGGTGCGGG - Intergenic
1125715361 15:41816938-41816960 GGACCGGCTGATCCATGTGCTGG + Exonic
1125806619 15:42498481-42498503 GTCCCAGCTGCTCCAGCTCCTGG - Intronic
1128813327 15:70587453-70587475 CGTCCGGCTGCTCCGAGTGCGGG + Intergenic
1128847975 15:70918126-70918148 GGGCAGGCAGCTCCAGGTGCTGG - Intronic
1129672594 15:77615603-77615625 GCTCCAGCTCCTCCAGGTGCGGG + Exonic
1130461731 15:84164411-84164433 GGTCTGGCTGCTCCAGGGGAAGG - Intergenic
1130711514 15:86286469-86286491 GTTCCCGCTCCTCCAGGCCCTGG + Intronic
1131055185 15:89370794-89370816 CGTCCGGCTACTCCAGGTCCAGG - Intergenic
1132828956 16:1918326-1918348 GGTCGCGCCGCTCCAGGCCCGGG + Exonic
1132978604 16:2722777-2722799 GGTCCGTGGGCTCCAGGTACAGG - Intergenic
1136117139 16:28101631-28101653 GAACGTGCTGCTCCAGGTCCTGG - Exonic
1136223606 16:28844452-28844474 GGAAAGGCTTCTCCAGGTCCCGG + Exonic
1138212321 16:55173899-55173921 GGTCAGGCTGCTGAAGGTTCTGG + Intergenic
1138497364 16:57416527-57416549 GGCCCGGCTCCTCCTGGCCCTGG + Intergenic
1139740944 16:69034383-69034405 GGTCAGGCAGCTATAGGTCCTGG - Intronic
1141517750 16:84557653-84557675 TGTCCAGCTCCTCCAGCTCCTGG - Intergenic
1142631434 17:1228982-1229004 CCTCCCGCTGCTCCAGGTCGCGG + Intronic
1142708186 17:1709601-1709623 GGTTAGGCTGCTCCAGAGCCCGG + Intronic
1142850390 17:2701811-2701833 GGTCCGGGTGCCTCAGGCCCAGG + Intronic
1143109307 17:4544577-4544599 GCTCCAGCAGCTCCAGGACCAGG + Exonic
1143223686 17:5282480-5282502 GGCCCGGCTGCGCCATGACCAGG - Exonic
1143904486 17:10198285-10198307 GATCACGCTGCTGCAGGTCCCGG - Exonic
1144581414 17:16461492-16461514 GTTCCTGCAGCTCCAGGTCTAGG - Intronic
1146162941 17:30569783-30569805 GGACCTGCAGGTCCAGGTCCTGG + Intergenic
1147056512 17:37839240-37839262 GGTCTCGCTGGTCCAGGTCGGGG - Intergenic
1147427962 17:40355267-40355289 GGTCCGGCTGCTCCAGGTCCTGG - Exonic
1147579937 17:41622549-41622571 GGACCTGCAGATCCAGGTCCTGG + Intronic
1147952153 17:44113233-44113255 TGTCTGGGTGCTCCAGGTTCTGG - Intronic
1150176796 17:63066106-63066128 GCTCCAGCTGACCCAGGTCCAGG - Intronic
1150216595 17:63474951-63474973 GTGTCAGCTGCTCCAGGTCCAGG + Intergenic
1150868709 17:68880669-68880691 GGGCAGGCTGCTCCAGGCACTGG - Intronic
1151584577 17:75001421-75001443 GGTTGGTCAGCTCCAGGTCCCGG - Exonic
1151954710 17:77374512-77374534 GGGGCGGGGGCTCCAGGTCCCGG - Intronic
1152090192 17:78242235-78242257 GGCCCAGCTCCGCCAGGTCCTGG + Intergenic
1152194553 17:78909559-78909581 GGTCCAGCTGCACCATGGCCAGG - Intronic
1152335454 17:79697999-79698021 GCAGTGGCTGCTCCAGGTCCCGG - Intergenic
1152377393 17:79925775-79925797 GGTCCCCCGGCCCCAGGTCCTGG + Intergenic
1152581057 17:81165799-81165821 GGTCCGGCTGCTTCTGCTGCTGG + Intronic
1152639997 17:81445374-81445396 GGGCGGGCTCCTCCAGATCCAGG - Exonic
1153328418 18:3846783-3846805 GGTCCCCCTACCCCAGGTCCAGG - Intronic
1153944850 18:10009495-10009517 GGTGCGGCTGCTGAGGGTCCTGG + Intergenic
1154357394 18:13632409-13632431 GGGCAGGCAGCTCCAGGTACTGG + Intronic
1157293426 18:46425555-46425577 GGTCCTGATGCTCCAGCCCCAGG - Intronic
1157742092 18:50102662-50102684 GGTGCTGCTGCTCCTGGTCTAGG - Intronic
1158788135 18:60740529-60740551 GGGCCGGCAGCTCCAGGAACCGG - Intergenic
1160297481 18:77651037-77651059 CGTCCAGCTGCTCGCGGTCCCGG - Intergenic
1160474066 18:79166957-79166979 GGGCAGGCAGCTCCAGGTGCCGG + Intronic
1160828274 19:1090745-1090767 GGTTCGGCTGCTGCAGGCCCAGG + Intronic
1163032394 19:14553220-14553242 GCTCCAGCTTCTCCGGGTCCCGG + Intronic
1163509544 19:17726767-17726789 GCCCCGGCCCCTCCAGGTCCTGG - Exonic
1163851865 19:19668913-19668935 GTTCTGGCTGCTCCAGCCCCAGG + Exonic
1164400174 19:27896650-27896672 AGGCCGGCTGCTCCTGGGCCTGG + Intergenic
1166313318 19:41975495-41975517 GCTCAGGCTCCTCCAGGGCCAGG + Intronic
1166521950 19:43486608-43486630 GGAGCGGCTGCTCAAGGCCCGGG - Exonic
1166783837 19:45356147-45356169 GATCCGGCTGGCCCAGGGCCTGG - Intronic
929764046 2:44829606-44829628 GTTCCGTCTGCTCTAGGTTCTGG + Intergenic
932398143 2:71462250-71462272 GGGCAGGCAGCTCCAGGTGCTGG + Intronic
933026935 2:77271449-77271471 TGGCTGGCTGCTCCAGGTGCTGG - Intronic
933042703 2:77488300-77488322 GGGCAGGCAGCTCCAGGTGCTGG - Intronic
933809932 2:86026895-86026917 CTTCCGGCTGCTCCAGCCCCTGG - Exonic
934656502 2:96119172-96119194 GCTCCGGCTGCTCCTGCTGCTGG - Intergenic
935896874 2:107747617-107747639 CGGCCGGCTGCTCCAAGTGCGGG + Intergenic
937262297 2:120594343-120594365 GGTGGGGCAGCTCCAGGTCTAGG - Intergenic
937980440 2:127611618-127611640 GGTCAGCCTGGTCCAGGGCCAGG - Intronic
939053236 2:137331886-137331908 CGGCCGGCTGCTCCAAGTGCGGG + Intronic
939972556 2:148678666-148678688 GGGCCGGCTGCTCCGAGTGCAGG + Intronic
942053363 2:172161679-172161701 GGACAGGCAGCTCCAGGTGCCGG + Intergenic
942168272 2:173264075-173264097 GATCCCGATGCTCCTGGTCCTGG - Intronic
943222821 2:185132681-185132703 AGGCCGGCTGCTCCGAGTCCGGG - Intergenic
947875966 2:233468526-233468548 GGTCCCTCCGCTCCAGGTGCAGG - Exonic
947946663 2:234109467-234109489 CCTCCAGCTGCTCCAGCTCCTGG + Intergenic
948046800 2:234951791-234951813 GGTGCCGCGGCTCCGGGTCCAGG - Intergenic
948182022 2:235989643-235989665 GTTCGGGCTGCACCAGCTCCTGG + Intronic
1170501145 20:16975848-16975870 GGTCAGGCAGCTCCAGGTGCTGG - Intergenic
1171132387 20:22665731-22665753 GGTCAGGCTGCCCAAGGTCTTGG - Intergenic
1171247774 20:23626525-23626547 GGTGCTGCTGCTGCTGGTCCAGG + Intergenic
1172956745 20:38765404-38765426 GCTCCAGCTGCTCCAGGTCAGGG - Exonic
1173516208 20:43667178-43667200 GCTCCGGCCGCTCCGGGCCCCGG - Exonic
1173517573 20:43675694-43675716 GGTCAGGCTTCCCCAGCTCCAGG + Intronic
1173819024 20:46008947-46008969 GGTCCTGGTGCTCCTGGTGCTGG + Exonic
1174356158 20:49999317-49999339 GTCCCGGCTCCTCCAGGTCTGGG - Intergenic
1175891226 20:62316893-62316915 GGTCCGCCTGCTGCAGGGCCTGG + Exonic
1176136019 20:63522370-63522392 GGTCCTGCTTGTCCAGCTCCAGG - Intergenic
1176364825 21:6026488-6026510 GGACCAGCTGTGCCAGGTCCGGG - Intergenic
1176993016 21:15521474-15521496 GGGCAGGCAGCTCCAGGTACTGG + Intergenic
1177637599 21:23807099-23807121 CGGCCGGCTGCTCCACGTGCGGG - Intergenic
1178408885 21:32347733-32347755 GGGCCTGCTGCTCCAGGGCCAGG + Exonic
1178707828 21:34889554-34889576 TGTCCGGCTGCTGCGGGTGCCGG - Intronic
1179400189 21:41076221-41076243 GGGCCGACAGCTCCAGGTGCTGG - Intergenic
1179626851 21:42653819-42653841 GATCCGGCTCCTCCAGCTACCGG + Exonic
1179758693 21:43512057-43512079 GGACCAGCTGTGCCAGGTCCGGG + Intergenic
1180007964 21:45032018-45032040 GGCCGGGTTGCTCCAGCTCCTGG - Intergenic
1180913817 22:19471596-19471618 GGGCCACCTGCTCCAGGGCCAGG + Intronic
1181050783 22:20237374-20237396 GGTCAGGCTTCTCCAGGGCTGGG - Intergenic
1181277473 22:21695692-21695714 GCTCTGGCTGGGCCAGGTCCTGG - Intronic
1182302032 22:29342302-29342324 GGACCTGCTGCACCAGCTCCTGG + Exonic
1182804328 22:33057921-33057943 GGTCCGGCCGCTGCGGTTCCTGG + Intronic
1183540622 22:38427409-38427431 GGTCCCGCTGGTCCAGGGGCAGG + Exonic
1184503042 22:44885449-44885471 GGTCCCGCTCCTCCAGCTGCTGG + Exonic
952258498 3:31716073-31716095 GATTCTGCTGCTGCAGGTCCAGG - Intronic
954452409 3:50578891-50578913 GGGCCAGCTGCTCCATGTCCTGG - Exonic
954737183 3:52716057-52716079 GGGCGGGCAGCTCCAGGTGCCGG - Intronic
955494086 3:59512983-59513005 GGTCCACCTGCTCCAGAGCCCGG - Intergenic
956801594 3:72764650-72764672 GATGCTGCTGCTCCTGGTCCAGG - Intronic
957560184 3:81812286-81812308 GGGCCGGCTGCTCCCAGTGCCGG + Intergenic
957630929 3:82715412-82715434 GGGCCGGCTGCTCCGAGTGCGGG - Intergenic
957653086 3:83034999-83035021 GGGCAGGCTGCTCCAGGTACCGG + Intergenic
957845064 3:85721573-85721595 GGGCGGGCAGCTCCAGGTGCCGG + Intronic
957923165 3:86772816-86772838 GGACAGGCAGCTCCAGGTGCTGG - Intergenic
958675446 3:97264360-97264382 GGACAGGCAGCTCCAGGTGCCGG + Intronic
959037581 3:101384568-101384590 GGACGGGCAGCTCCAGGTGCTGG - Intronic
961461975 3:127056385-127056407 TGGCCGGCTGCTCCAAGTGCGGG + Intergenic
962105053 3:132381608-132381630 GGGCGGGCAGCTCCAGGTGCCGG + Intergenic
962369998 3:134813409-134813431 GGTCCTGCTTCTCCAGGGACAGG + Intronic
962889645 3:139660121-139660143 GGTCTGCCTGGTCCAGCTCCTGG + Intronic
963454151 3:145522406-145522428 GGGCAGGCAGCTCCAGGTACTGG + Intergenic
963956647 3:151261571-151261593 GGTCATGCTGATCCAGGCCCAGG - Intronic
964716988 3:159732830-159732852 GGTCCTGTAGCTCCAGCTCCTGG - Intronic
966474151 3:180324866-180324888 GTTCCGGCTGCTCCAGATGGAGG + Intergenic
967104145 3:186242038-186242060 GGTCCTCCTGGTCCAAGTCCCGG + Intronic
968097931 3:195945324-195945346 GGTCCTGCAGCTGCAGATCCGGG - Intergenic
968464397 4:743226-743248 AGACCGGCTGCTCCAGGCCTAGG - Intronic
968726693 4:2251228-2251250 GGTCCTGCTCCTCCAGTTTCTGG + Exonic
969053324 4:4387296-4387318 GGTGCGGCGGCCCCAGGACCGGG + Intronic
971869289 4:32215514-32215536 GGGCTGGCAGCTCCAGGTGCCGG + Intergenic
972645943 4:40967574-40967596 GGGCAGGCAGCTCCAGGTGCTGG - Intronic
972930922 4:44071035-44071057 GGGCAGGCAGCTCCAGGTGCTGG + Intergenic
974055211 4:56977192-56977214 GGTCCGGGTGCCCCACGACCGGG + Exonic
976511002 4:85910073-85910095 GGACCTGCAGCTCCAGGTGCCGG + Intronic
976922572 4:90457101-90457123 TGGCGGGCTGCTCCAGGTGCTGG + Intronic
982358072 4:154490944-154490966 GGTCCCGCCGCTCGCGGTCCAGG + Intronic
983061546 4:163166630-163166652 GGTCCGGCGGCTCCGTCTCCGGG - Exonic
984069275 4:175092194-175092216 CAGCCGGCTGCTCCAGGTGCGGG - Intergenic
984373282 4:178894311-178894333 GGGCAGGCAGCTCCAGGTGCTGG + Intergenic
984811262 4:183797952-183797974 GGTCCTGCTGATCCAGGGCAAGG + Intergenic
984956890 4:185053803-185053825 GGCCCAGCTCCTCCAGGACCCGG + Intergenic
985686122 5:1282679-1282701 TGTCCGGATGGTGCAGGTCCGGG - Intronic
985686170 5:1282867-1282889 TGTCTGGATGCTGCAGGTCCGGG - Intronic
985686306 5:1283476-1283498 TGTCCGGATGGTGCAGGTCCGGG - Intronic
985686322 5:1283537-1283559 TGTCCGGATGGTGCAGGTCCGGG - Intronic
985686396 5:1283839-1283861 TGTCCGGATGGTGCAGGTCCAGG - Intronic
985686413 5:1283907-1283929 TGTCCGGTTGCTGCAGGTCCGGG - Intronic
985686454 5:1284090-1284112 AGTCCGGATGATGCAGGTCCGGG - Intronic
985686483 5:1284211-1284233 AGTCCGGATGATGCAGGTCCGGG - Intronic
985686512 5:1284332-1284354 AGTCCGGATGATGCAGGTCCGGG - Intronic
985686662 5:1285010-1285032 AGTCCGGATGATGCAGGTCCGGG - Intronic
985686691 5:1285131-1285153 AGTCCGGATGATGCAGGTCCGGG - Intronic
985791572 5:1931083-1931105 GCCCCGGCTGCTCCACGCCCAGG + Intergenic
987543812 5:19287827-19287849 CGGCCGGCTGCTCCAAGTGCCGG - Intergenic
988093117 5:26568529-26568551 GGGCAGGCAGCTCCAGGTGCTGG + Intergenic
989821805 5:45801355-45801377 GGGCAGGCAGCTCCAGGTGCTGG - Intergenic
989956830 5:50369521-50369543 TGGCCGGCTGCTCCAAGTGCAGG - Intergenic
991444029 5:66680860-66680882 GGTGCGCTTGCTCCAGGTCAAGG - Intronic
992084847 5:73269284-73269306 GCTCCAGCTGCTCCAGGACCTGG - Intergenic
992226572 5:74624717-74624739 TGACCTGCTCCTCCAGGTCCAGG - Intergenic
992556806 5:77911946-77911968 GGTCAGGTTTCTCCAGGTCAGGG - Intergenic
992736817 5:79730121-79730143 GGTCCGGCTGTTCTTGGTCTGGG - Exonic
993236058 5:85311725-85311747 GGACGGGCAGCTCCAGGTGCTGG - Intergenic
994229949 5:97301231-97301253 CGGCCGGCTGCTCCAAGTGCAGG - Intergenic
994518069 5:100794929-100794951 GGGCAGGCAGCTCCAGGTGCTGG - Intergenic
994898083 5:105731187-105731209 GGTGGGGCAGCTCCAGGCCCAGG - Intergenic
995224753 5:109689963-109689985 GGTTCGGCAGCTCCCGGGCCGGG - Exonic
997191941 5:131945655-131945677 GGCCCGGCGGCTCCAGTTCTGGG - Intronic
997825819 5:137106140-137106162 GTTGCTACTGCTCCAGGTCCTGG - Intronic
998402936 5:141857414-141857436 GGTCCTGCAGCTCCTGGGCCTGG + Exonic
1000266384 5:159641789-159641811 GGGCAGGCAGCTCCAGGTGCTGG - Intergenic
1001152517 5:169244709-169244731 GCTCTAGCTGCTTCAGGTCCTGG + Exonic
1002066961 5:176656696-176656718 AGCCCTGCTGCTCCAGCTCCTGG - Exonic
1002221724 5:177688318-177688340 CGGCCGGCTGCTCCAAGTGCGGG - Intergenic
1002690707 5:181048069-181048091 GCTCCTGCTGCTCCTGGTACAGG - Exonic
1003508853 6:6762757-6762779 TGGCCGGCTGCTCCAAGTGCGGG + Intergenic
1003671522 6:8164420-8164442 GGGCCGGCTGCTCCGAGTGCGGG - Intergenic
1003747995 6:9024361-9024383 GGCCCGGCTGCTCCGAGTGCGGG - Intergenic
1003770174 6:9290713-9290735 GGGCCGGCTGCTCCGAGTGCGGG + Intergenic
1004499688 6:16198368-16198390 GGGCCGGCTGCTCCCAGTGCGGG + Intergenic
1007214896 6:40229206-40229228 GGACAGGCAGCTCCAGGTGCTGG - Intergenic
1009800710 6:68533516-68533538 CGGCCGGCTGCTCCAAGTGCAGG - Intergenic
1010205062 6:73315112-73315134 GCCTCGGCTGCTCCAGGTGCTGG + Intergenic
1010282246 6:74035488-74035510 GGACCTGCTGATCCAGGTGCAGG + Intergenic
1010373703 6:75141415-75141437 GCTCCGTCTGCTGCAGCTCCTGG - Intronic
1011601596 6:89065107-89065129 GGGCTGGCTGCTCCAAGTGCGGG - Intergenic
1012231063 6:96761996-96762018 GGGCAGTCAGCTCCAGGTCCCGG + Intergenic
1012749427 6:103139624-103139646 GGGCAGGCAGCTCCAGGTGCTGG + Intergenic
1015096103 6:129416873-129416895 GGCTGGGCAGCTCCAGGTCCTGG + Intronic
1016590155 6:145735324-145735346 GGCCCGGCTCCTGCAGGGCCAGG + Exonic
1017002323 6:150005080-150005102 TGTCCGGCTGGTCCGGGTCAGGG - Intergenic
1017581240 6:155867032-155867054 CGGCCGGCTGCTCCAAGTGCGGG + Intergenic
1017672142 6:156778382-156778404 GTTGCGGCTGCTCCATGTCGGGG - Exonic
1018633921 6:165843913-165843935 GCTCCTGCTGCTCCAGGTGTGGG - Intronic
1019287168 7:229427-229449 GCTGCAGCTGGTCCAGGTCCTGG + Exonic
1019494047 7:1329370-1329392 GGTCCGGCGACTTTAGGTCCAGG - Intergenic
1019500032 7:1360192-1360214 GGTCCAGATGCCCCATGTCCCGG + Intergenic
1019605683 7:1909080-1909102 GGTCCCGCTGCTCCGAGTCTGGG - Intronic
1019735553 7:2648314-2648336 GGGCAGGTTGCTTCAGGTCCTGG - Intronic
1020784454 7:12556435-12556457 GGTCCCGCCGCTCCAAGTGCAGG + Intergenic
1021761297 7:23904992-23905014 GGGCCGGCGGCTCCAAGTGCGGG + Intergenic
1022976728 7:35565451-35565473 GGTAGGGCTGCTCCAGGGACAGG + Intergenic
1023127923 7:36973825-36973847 GGGCCGGCTGCTCCGAGTGCGGG - Intronic
1024269058 7:47628560-47628582 CGGCCGGCTGCTCCGGGTGCGGG - Intergenic
1024318786 7:48045158-48045180 AGACCACCTGCTCCAGGTCCTGG + Intronic
1024700654 7:51901172-51901194 GGGCCGGCTGCTCCAAGTGCAGG + Intergenic
1024786393 7:52911929-52911951 TGTCAGGCAGCTCCAAGTCCCGG - Intergenic
1025915985 7:65866528-65866550 TGTGTGGCTGCTGCAGGTCCTGG - Intergenic
1026852858 7:73735785-73735807 GGCCCAGCTGCTGGAGGTCCTGG + Intergenic
1026880000 7:73901965-73901987 AGTCCCTCTGCTCCAGGTCCTGG + Intergenic
1026964614 7:74431247-74431269 GGCCGGGCTGCCCCAGGGCCAGG + Intergenic
1027238027 7:76309714-76309736 CGGCCGGCTGCTCCAAGTGCGGG + Intergenic
1031307988 7:120157703-120157725 GGTCCTGCTCCTCCAGGTGTAGG - Intergenic
1031921858 7:127608300-127608322 GGGCAGGCAGCTCCAGGTGCTGG + Intergenic
1032858509 7:135857331-135857353 GGGCAGGCAGCTCCAGGTGCTGG + Intergenic
1034222231 7:149455548-149455570 GGACCCGCTGCTCCAGAGCCCGG - Exonic
1034338224 7:150337017-150337039 GGTCCAGCCACTCCAGGCCCAGG - Exonic
1035736545 8:1891533-1891555 GGTCAGGCTGGGCCAGGCCCAGG + Intronic
1036783816 8:11671913-11671935 GCTGTGGCTGCTCCAGGCCCAGG - Intergenic
1037807710 8:22067592-22067614 GGTCGGGCCGCTCGATGTCCAGG - Exonic
1038716842 8:29998805-29998827 GGGCCTGCTACTTCAGGTCCAGG + Intergenic
1039069132 8:33634110-33634132 GGTCCGGCTGCTCCCAGTGCGGG + Intergenic
1042175907 8:66036874-66036896 GGTCCCCCTGCCCCAGGCCCTGG - Intronic
1043695634 8:83213123-83213145 GGACCTGCTGCTCCAGGAACTGG - Intergenic
1044524861 8:93240818-93240840 GGGCAGGCAGCTCCAGGTGCCGG + Intergenic
1044727001 8:95202166-95202188 GGTGCAGCAGCTTCAGGTCCCGG - Intergenic
1044880681 8:96719364-96719386 TGGCCGGCTGCTCCAAGTGCGGG + Intronic
1046450696 8:114386239-114386261 CGGCCGGCTGCTCCGGGTGCAGG - Intergenic
1047318249 8:123754380-123754402 GGGCAGGCAGCTCCAGGTGCTGG + Intergenic
1048789153 8:138084218-138084240 CGGCCGGCTGCTCCAAGTGCGGG - Intergenic
1049165465 8:141122781-141122803 GGTCCTGCTTCTCCATTTCCAGG + Intronic
1049233216 8:141494898-141494920 GTTCCGGCTGTTCCAGACCCTGG - Intergenic
1049565259 8:143334831-143334853 GGTGCGGCTGCTGCGGCTCCGGG - Exonic
1049800444 8:144515201-144515223 GCCCCAGCTGCTCCAGGGCCTGG + Exonic
1049936581 9:505421-505443 GGTCCCGCGGTTCCAGGTCGAGG + Intronic
1053196622 9:36124914-36124936 GGTCCTGATGTTCCAGTTCCAGG + Intergenic
1055561328 9:77524961-77524983 GGTACGGCTTCCCCAGGACCAGG + Intronic
1056512152 9:87316351-87316373 GATTTGGCTGCTCCATGTCCTGG - Intergenic
1057227066 9:93298033-93298055 GGTGCGGCAGCTCAAGGTCGTGG + Exonic
1059921764 9:119167899-119167921 GGTACTTCAGCTCCAGGTCCTGG + Exonic
1060929395 9:127479421-127479443 GCTCCCGCTGCCCCAGTTCCAGG - Exonic
1061048277 9:128179243-128179265 GGTCCTGCAGGTCCAGGCCCAGG - Exonic
1061139102 9:128753582-128753604 GGTACAGCTCCACCAGGTCCTGG + Exonic
1061499171 9:130992366-130992388 GCTCCGGCTGCCCTAGGGCCTGG - Intergenic
1061807362 9:133143998-133144020 GGTCCTGCTGCTCCTGGTGGGGG - Intronic
1062048150 9:134433880-134433902 GGCCAGGCTGCTCTGGGTCCAGG - Intronic
1062059234 9:134486115-134486137 GGCCCGGCTGCTCCTGGGCAGGG + Intergenic
1062373200 9:136250845-136250867 GGTCCAGCTGCTCCCGGGCGAGG + Intergenic
1062402316 9:136378052-136378074 GGGGCGGCTTCTCCAGGTCCAGG + Exonic
1186515840 X:10165535-10165557 GGGGAGGCTGCTCCTGGTCCTGG + Intronic
1186805956 X:13140180-13140202 GGGCGGGCAGCTCCAGGTGCTGG - Intergenic
1187400412 X:18954502-18954524 GGTCTCCCTGCTCCAGGTCCCGG - Intronic
1190216272 X:48481496-48481518 GTTCCGGCTGCTCCTGGGCTTGG - Exonic
1190339568 X:49286145-49286167 GGTAGAGCTGCTCCAGCTCCTGG - Exonic
1190683423 X:52849352-52849374 GGACCTGCTGATCCAGGTACGGG + Intergenic
1195470012 X:105220179-105220201 GGCCAGGCTGCCCCAGGTGCAGG + Exonic
1195688177 X:107603724-107603746 GGTCCGCTTGCTTCAGGCCCTGG - Exonic
1195732660 X:107981909-107981931 GGCCAGGCTGCCCCAGGTGCAGG + Exonic
1199471447 X:148199924-148199946 TGTCCCTCTGCTCCAGTTCCTGG - Intergenic
1202377539 Y:24250739-24250761 GGTCTGGCTGCTCCAGGGGAAGG + Intergenic
1202493242 Y:25419383-25419405 GGTCTGGCTGCTCCAGGGGAAGG - Intergenic