ID: 1147427962

View in Genome Browser
Species Human (GRCh38)
Location 17:40355267-40355289
Sequence GGTCCGGCTGCTCCAGGTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 349}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147427962_1147427971 10 Left 1147427962 17:40355267-40355289 CCAGGACCTGGAGCAGCCGGACC 0: 1
1: 0
2: 1
3: 29
4: 349
Right 1147427971 17:40355300-40355322 GCTGCAGGAGCCGCTGCTGGAGG 0: 1
1: 1
2: 7
3: 97
4: 691
1147427962_1147427970 7 Left 1147427962 17:40355267-40355289 CCAGGACCTGGAGCAGCCGGACC 0: 1
1: 0
2: 1
3: 29
4: 349
Right 1147427970 17:40355297-40355319 CATGCTGCAGGAGCCGCTGCTGG 0: 1
1: 1
2: 2
3: 37
4: 366
1147427962_1147427972 19 Left 1147427962 17:40355267-40355289 CCAGGACCTGGAGCAGCCGGACC 0: 1
1: 0
2: 1
3: 29
4: 349
Right 1147427972 17:40355309-40355331 GCCGCTGCTGGAGGCGCTAAAGG 0: 1
1: 0
2: 0
3: 6
4: 104
1147427962_1147427968 -5 Left 1147427962 17:40355267-40355289 CCAGGACCTGGAGCAGCCGGACC 0: 1
1: 0
2: 1
3: 29
4: 349
Right 1147427968 17:40355285-40355307 GGACCGGGTGGACATGCTGCAGG 0: 1
1: 0
2: 1
3: 18
4: 137
1147427962_1147427974 30 Left 1147427962 17:40355267-40355289 CCAGGACCTGGAGCAGCCGGACC 0: 1
1: 0
2: 1
3: 29
4: 349
Right 1147427974 17:40355320-40355342 AGGCGCTAAAGGTCTACGTGCGG 0: 1
1: 0
2: 1
3: 3
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147427962 Original CRISPR GGTCCGGCTGCTCCAGGTCC TGG (reversed) Exonic