ID: 1147431114

View in Genome Browser
Species Human (GRCh38)
Location 17:40371393-40371415
Sequence TGGCCCTTTTCTGAGACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147431114_1147431125 21 Left 1147431114 17:40371393-40371415 CCCCCTGTCTCAGAAAAGGGCCA No data
Right 1147431125 17:40371437-40371459 TTGCTCACATGTCATTGGGTAGG No data
1147431114_1147431124 17 Left 1147431114 17:40371393-40371415 CCCCCTGTCTCAGAAAAGGGCCA No data
Right 1147431124 17:40371433-40371455 CGATTTGCTCACATGTCATTGGG No data
1147431114_1147431123 16 Left 1147431114 17:40371393-40371415 CCCCCTGTCTCAGAAAAGGGCCA No data
Right 1147431123 17:40371432-40371454 CCGATTTGCTCACATGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147431114 Original CRISPR TGGCCCTTTTCTGAGACAGG GGG (reversed) Intergenic
No off target data available for this crispr