ID: 1147431142

View in Genome Browser
Species Human (GRCh38)
Location 17:40371523-40371545
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147431142_1147431148 27 Left 1147431142 17:40371523-40371545 CCAGGAGGGAGCAGGGAGACTCC No data
Right 1147431148 17:40371573-40371595 TTGGTCCCCCACGCTGACATGGG No data
1147431142_1147431145 2 Left 1147431142 17:40371523-40371545 CCAGGAGGGAGCAGGGAGACTCC No data
Right 1147431145 17:40371548-40371570 CGCTGTCACAGATCTGCTTCTGG No data
1147431142_1147431147 26 Left 1147431142 17:40371523-40371545 CCAGGAGGGAGCAGGGAGACTCC No data
Right 1147431147 17:40371572-40371594 ATTGGTCCCCCACGCTGACATGG No data
1147431142_1147431146 8 Left 1147431142 17:40371523-40371545 CCAGGAGGGAGCAGGGAGACTCC No data
Right 1147431146 17:40371554-40371576 CACAGATCTGCTTCTGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147431142 Original CRISPR GGAGTCTCCCTGCTCCCTCC TGG (reversed) Intergenic
No off target data available for this crispr