ID: 1147431145

View in Genome Browser
Species Human (GRCh38)
Location 17:40371548-40371570
Sequence CGCTGTCACAGATCTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147431142_1147431145 2 Left 1147431142 17:40371523-40371545 CCAGGAGGGAGCAGGGAGACTCC No data
Right 1147431145 17:40371548-40371570 CGCTGTCACAGATCTGCTTCTGG No data
1147431141_1147431145 3 Left 1147431141 17:40371522-40371544 CCCAGGAGGGAGCAGGGAGACTC No data
Right 1147431145 17:40371548-40371570 CGCTGTCACAGATCTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147431145 Original CRISPR CGCTGTCACAGATCTGCTTC TGG Intergenic
No off target data available for this crispr