ID: 1147431146

View in Genome Browser
Species Human (GRCh38)
Location 17:40371554-40371576
Sequence CACAGATCTGCTTCTGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147431141_1147431146 9 Left 1147431141 17:40371522-40371544 CCCAGGAGGGAGCAGGGAGACTC No data
Right 1147431146 17:40371554-40371576 CACAGATCTGCTTCTGGCATTGG No data
1147431142_1147431146 8 Left 1147431142 17:40371523-40371545 CCAGGAGGGAGCAGGGAGACTCC No data
Right 1147431146 17:40371554-40371576 CACAGATCTGCTTCTGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147431146 Original CRISPR CACAGATCTGCTTCTGGCAT TGG Intergenic
No off target data available for this crispr