ID: 1147431147

View in Genome Browser
Species Human (GRCh38)
Location 17:40371572-40371594
Sequence ATTGGTCCCCCACGCTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147431143_1147431147 5 Left 1147431143 17:40371544-40371566 CCCTCGCTGTCACAGATCTGCTT No data
Right 1147431147 17:40371572-40371594 ATTGGTCCCCCACGCTGACATGG No data
1147431144_1147431147 4 Left 1147431144 17:40371545-40371567 CCTCGCTGTCACAGATCTGCTTC No data
Right 1147431147 17:40371572-40371594 ATTGGTCCCCCACGCTGACATGG No data
1147431142_1147431147 26 Left 1147431142 17:40371523-40371545 CCAGGAGGGAGCAGGGAGACTCC No data
Right 1147431147 17:40371572-40371594 ATTGGTCCCCCACGCTGACATGG No data
1147431141_1147431147 27 Left 1147431141 17:40371522-40371544 CCCAGGAGGGAGCAGGGAGACTC No data
Right 1147431147 17:40371572-40371594 ATTGGTCCCCCACGCTGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147431147 Original CRISPR ATTGGTCCCCCACGCTGACA TGG Intergenic
No off target data available for this crispr