ID: 1147433671

View in Genome Browser
Species Human (GRCh38)
Location 17:40392646-40392668
Sequence GGTCTGATTCAGAATCAGAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147433671_1147433675 8 Left 1147433671 17:40392646-40392668 CCTATCTGATTCTGAATCAGACC 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1147433675 17:40392677-40392699 CTCTTCTTTCCTTTTTTGATTGG 0: 1
1: 1
2: 5
3: 117
4: 1096

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147433671 Original CRISPR GGTCTGATTCAGAATCAGAT AGG (reversed) Exonic
904899080 1:33842086-33842108 GGTCTGGGGCAGAAACAGATGGG - Intronic
906874161 1:49517876-49517898 AGTCTGATTCAATATTAGATTGG - Intronic
909381827 1:75007134-75007156 GATTTTATTCTGAATCAGATGGG - Intergenic
911533156 1:99070199-99070221 GGGCTCTTTCAGAAGCAGATTGG - Intergenic
911951665 1:104181228-104181250 GGTCAGAAACAGGATCAGATAGG - Intergenic
912257288 1:108073388-108073410 TGACTGATAGAGAATCAGATAGG - Intergenic
915799633 1:158776300-158776322 GGTCTGAGCCAAAATAAGATTGG + Intergenic
917770358 1:178270694-178270716 GGTCTGCTTCAGATTAAGAATGG + Intronic
922901969 1:229144269-229144291 GGCCTGGTTCAAAAACAGATTGG + Intergenic
923414199 1:233738996-233739018 GGCATTATTCAGAATCAGACGGG - Intergenic
1063013461 10:2049714-2049736 GATATGACTCAGAATCATATAGG + Intergenic
1063013468 10:2049758-2049780 GATATGACTCAGAATCATATGGG + Intergenic
1063013476 10:2049823-2049845 GATATGACTCAGAATCATATAGG + Intergenic
1067780606 10:49202614-49202636 TGTCTGCTTCAGACTCACATTGG - Intergenic
1069246879 10:66217925-66217947 GGCATTATTCAGAATCAGTTAGG - Intronic
1072512121 10:96138266-96138288 GGTTTTATTCTGAATCAGAGAGG - Intronic
1073564295 10:104522033-104522055 GTTCTGTTTCAGAATCAGAATGG + Intergenic
1075453298 10:122568333-122568355 GGGCTGAGTCAGAACCAGAGAGG + Intronic
1076143894 10:128101400-128101422 GTTCTCATGCAGAATCAGAAAGG - Exonic
1080531180 11:33178248-33178270 GGTTTAATTCTGAATCAAATGGG - Intergenic
1088964695 11:114706883-114706905 TATGTGATTCAAAATCAGATTGG + Exonic
1089738505 11:120565527-120565549 GGGATGATTCAGAACAAGATTGG - Intronic
1092328448 12:7559892-7559914 GGACTGATTCTAATTCAGATTGG + Intergenic
1093451204 12:19316948-19316970 GCTATGATTCAGAATAAAATAGG - Intronic
1093863719 12:24199231-24199253 CGTCTGTTCCAGAATAAGATAGG + Intergenic
1095129354 12:38520511-38520533 GCTTTTACTCAGAATCAGATGGG - Intergenic
1102721207 12:115017944-115017966 TGCCTGGTTCAGAATCACATTGG + Intergenic
1104240362 12:126983612-126983634 CATCTGATTAAGAATCACATTGG + Intergenic
1109683357 13:65782840-65782862 GATATGATTCAAAATAAGATAGG - Intergenic
1110740582 13:78991347-78991369 GGACTGATACAGTATGAGATAGG - Intergenic
1114867863 14:26619924-26619946 GGTCTGATTTGAACTCAGATAGG - Intergenic
1115414996 14:33122167-33122189 TGTCTGCTCCAGAATCAGAAAGG - Intronic
1120909301 14:89651252-89651274 TGTCAGATTCAGAATCTGCTGGG - Intergenic
1121973259 14:98378819-98378841 GGAATGATTCAGAACCAGAGTGG + Intergenic
1124383231 15:29185277-29185299 GGTGTGATTCCGAAACCGATAGG - Intronic
1126829625 15:52587967-52587989 GTTCTGATTTAGAATCAATTTGG - Intronic
1130284027 15:82540681-82540703 GGTCCCATTAAAAATCAGATGGG - Intronic
1130866943 15:87941227-87941249 GGTACGATTGAGAATCAGGTTGG + Intronic
1131898635 15:97062610-97062632 GGTCTCCTTCAGAGTCAGAGTGG - Intergenic
1135071549 16:19356484-19356506 GATCTCATTCATAATCAGCTTGG - Intergenic
1135233091 16:20727985-20728007 GGTGTGCTTTAGAATCAAATTGG - Intronic
1135498805 16:22975942-22975964 GGTCAGTTTCAGAATCACCTGGG - Intergenic
1135688936 16:24520890-24520912 GGTCTGCATCAGAATCACCTGGG + Intergenic
1138282979 16:55786142-55786164 GGTCAGATACAGAAGCAGGTGGG - Intergenic
1141818907 16:86431748-86431770 GGTCTGACTCAGCACCAGAGTGG + Intergenic
1143328796 17:6119225-6119247 TGTCTGATTCTGGGTCAGATTGG + Intronic
1147433671 17:40392646-40392668 GGTCTGATTCAGAATCAGATAGG - Exonic
1149851054 17:60034319-60034341 GGTGTGTTTCAGAATCATCTGGG - Intergenic
1149859112 17:60112195-60112217 GGTGTGTTTCAGAATCATCTGGG + Intergenic
1152513173 17:80804066-80804088 GGTCTGAGTCAGACTCACACAGG - Intronic
1159206612 18:65261633-65261655 TGTCTGATTCAGCATCACAAAGG - Intergenic
1163274211 19:16272837-16272859 GGTCTAATTGAGATTCACATAGG + Intergenic
1168720415 19:58551684-58551706 GGTCTGCATCAGCATCAGCTAGG + Exonic
932689135 2:73897490-73897512 GGCCTGACTTAGAATCACATGGG - Intronic
935284269 2:101550118-101550140 GGTTATATTTAGAATCAGATAGG - Intergenic
935362563 2:102259804-102259826 GGTCTCACTCAGAATCAACTGGG - Intergenic
935432787 2:102994399-102994421 GCTCTCATTCAGAAACAGAGTGG - Intergenic
936843851 2:116806160-116806182 GAACTGATTCAGAATCAGAGTGG + Intergenic
938176491 2:129136185-129136207 TGTCTCATTCACAATCAGAGGGG + Intergenic
938592703 2:132754904-132754926 ATTCTAGTTCAGAATCAGATTGG + Intronic
938646534 2:133336728-133336750 GAGCTGTTTCAGACTCAGATAGG - Intronic
941891709 2:170588982-170589004 GGTGTGAATAAGAATGAGATTGG + Intronic
944298797 2:198098652-198098674 GGTCTAATTCAGGATAAAATGGG + Intronic
1171148911 20:22810005-22810027 GGTCTGATTTGGGGTCAGATGGG - Intergenic
1172668153 20:36614964-36614986 GCTCTGAGTCAGAACCAGAGTGG + Intronic
1172879994 20:38193713-38193735 GGTCTGGGTCAGTATCAGAGAGG + Intergenic
1181858542 22:25800434-25800456 GGTCTGTTTCTGACTCAGGTTGG - Intronic
1182463071 22:30495788-30495810 GGTCTGATGCAGAAAGAGATCGG + Intronic
1184611009 22:45603051-45603073 TCCCTGATTCTGAATCAGATAGG - Intergenic
1184611010 22:45603053-45603075 TATCTGATTCAGAATCAGGGAGG + Intergenic
951131502 3:19051472-19051494 GATTGGGTTCAGAATCAGATTGG - Intergenic
953638461 3:44683832-44683854 TGTCTGATGGAGAATAAGATGGG + Intergenic
956982147 3:74651400-74651422 GGTCTGTTTCTGACTCAGCTGGG + Intergenic
960098864 3:113716951-113716973 GATCTGATTCAGAAATAGTTGGG - Exonic
961545184 3:127628698-127628720 AGTCTGGCTCAGGATCAGATTGG - Intergenic
961588721 3:127958535-127958557 GGTATCACTCAGGATCAGATGGG + Intronic
963917952 3:150877372-150877394 GGTCTCATACAGAATCAGAAAGG + Intronic
964421339 3:156506716-156506738 GTTCTGATTCAGAATCAGTTTGG + Intronic
966758406 3:183392929-183392951 GATCTGCTTCAGATTCAGACAGG + Intronic
970967108 4:21941343-21941365 GATCAGAATCAAAATCAGATTGG - Intronic
971073438 4:23121435-23121457 AGTTTGATGCAGAAGCAGATAGG - Intergenic
971238841 4:24869197-24869219 GGCCTGTTTCAGGGTCAGATGGG - Intronic
973064473 4:45771243-45771265 TGCCAGATTCAGAATCACATTGG + Intergenic
973304523 4:48630444-48630466 GGTCTAAATCAGAAGAAGATAGG + Intronic
974033904 4:56800466-56800488 GGTCTTATTAAAAATCAGAGTGG - Intergenic
977853383 4:101857812-101857834 GGTCAAATTAAGAAACAGATTGG - Intronic
978457049 4:108906120-108906142 GCTCTTATTCTGAATGAGATGGG - Intronic
983386312 4:167067064-167067086 AGTTTGATACAGAATCAGTTGGG + Intronic
983662690 4:170145568-170145590 GGTCTAATTCAGAAAGAGTTGGG + Intergenic
985885996 5:2679060-2679082 TGTCTGACTCAGAGACAGATAGG - Intergenic
986214266 5:5704068-5704090 TGTCTCATTCAGAATCAGACCGG + Intergenic
988427324 5:31078816-31078838 ATTCTGATTCAGAGTAAGATTGG - Intergenic
988585981 5:32507890-32507912 GGCATTATTCAGAATCAGCTGGG + Intergenic
989685471 5:44081560-44081582 GGGATGATGCAGAAGCAGATGGG + Intergenic
990763991 5:59161996-59162018 GGTCTGATTTGAAAGCAGATTGG + Intronic
993161082 5:84292375-84292397 TGTCTTATTCAGCATGAGATGGG - Intronic
995270074 5:110209815-110209837 GGTCTAATTCAGAATCTGCAAGG - Intergenic
995683015 5:114741768-114741790 GGTGTGTCTCAGAATGAGATTGG - Intergenic
998168274 5:139856756-139856778 GGTCTGCCTGTGAATCAGATAGG - Intronic
1001063024 5:168510540-168510562 AGTCTGTTTCAAAATCTGATTGG + Intronic
1007152486 6:39707872-39707894 TGTCTGATTCAGAGTCACATAGG + Intronic
1007218775 6:40262257-40262279 GGTCTGCATCAGAATCACCTGGG + Intergenic
1012638450 6:101578564-101578586 GGACTGCTTCAGAATCATTTGGG + Intronic
1013648900 6:112173622-112173644 GTTCTGAGTCAGACTCAGAAAGG - Intronic
1013873336 6:114794897-114794919 TGTCTGCTTCAGAATGAGAAGGG + Intergenic
1016267182 6:142246283-142246305 TTTCTGAATCAGAATCAGAGTGG - Intergenic
1016339828 6:143050599-143050621 GTTCTGATTCACATTCATATCGG - Intergenic
1016516144 6:144894883-144894905 GATCTGTTTCAGAATCCAATAGG + Intergenic
1017727138 6:157283661-157283683 AGCCTGAATCAGAATCAGCTGGG - Intergenic
1018460353 6:163992935-163992957 GCCCTGACTCAGAATCAGATGGG + Intergenic
1018460561 6:163994770-163994792 GCCCTGACTCAGAATCAGGTGGG + Intergenic
1022554357 7:31277168-31277190 AGTTTGAGTAAGAATCAGATGGG + Intergenic
1026244752 7:68609786-68609808 GGTCTCTTGCAGAATGAGATTGG - Intergenic
1028441609 7:90869495-90869517 GCTTTGACTCAGAATGAGATGGG + Intronic
1028452813 7:91004985-91005007 GTTCAGATTCAGAATCTCATTGG + Intronic
1028582853 7:92424936-92424958 AGTCTTATTTGGAATCAGATGGG + Intergenic
1030632859 7:111914415-111914437 GGTCTTATTCAGAATGAGAAAGG - Intronic
1031552023 7:123126335-123126357 AGACTGATTCAGGAACAGATGGG + Intronic
1034128466 7:148695324-148695346 GCTTTGCTTCAGAATCAGCTGGG - Intergenic
1034828578 7:154289380-154289402 GGTCAAAGTCAGGATCAGATGGG - Intronic
1035107583 7:156455091-156455113 GTTCTGAGTCACAATCAGAAAGG - Intergenic
1036491871 8:9234617-9234639 GATTGGATTCAAAATCAGATTGG - Intergenic
1036595622 8:10209430-10209452 GGGCAGATTCAGTACCAGATGGG + Intronic
1037684958 8:21130762-21130784 GGTCTGATTCACCATCTGCTGGG - Intergenic
1037920918 8:22804874-22804896 GGCGTGTTCCAGAATCAGATGGG - Intronic
1038481226 8:27903023-27903045 GGCATGATTCAGGATCAAATAGG - Intronic
1040877907 8:52172093-52172115 GGTGTGATTCTGAAACAGAAAGG - Exonic
1041334980 8:56772017-56772039 GGGTTTACTCAGAATCAGATGGG + Intergenic
1041856195 8:62458174-62458196 GGCCTGTTTCAGAAGCAGCTGGG - Intronic
1042906223 8:73774844-73774866 GCTCTGGATCAGAATCAGCTGGG + Intronic
1044122634 8:88416299-88416321 GTTGTGATTCAGAGTCAGAGGGG - Intergenic
1044708995 8:95037286-95037308 GCTCTGATTCAGAAGGAAATCGG - Intronic
1045763101 8:105633994-105634016 GATCTGATTCAGTATCATTTAGG + Intronic
1046187414 8:110739871-110739893 AGACTGATTCAGAATCAGGATGG - Intergenic
1046579818 8:116078318-116078340 GGTATGTTTCAGAATCATTTGGG - Intergenic
1047461535 8:125070293-125070315 TGTGTGACTCACAATCAGATAGG + Intronic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1049151518 8:141038070-141038092 GTTCTGACTCATAACCAGATGGG - Intergenic
1054902630 9:70386019-70386041 TTTCTGATTCAGAATCAGTGTGG - Exonic
1057523740 9:95781781-95781803 CGTAGGCTTCAGAATCAGATTGG + Intergenic
1060669198 9:125453422-125453444 GATCAAATGCAGAATCAGATTGG - Intronic
1188359023 X:29229633-29229655 GATCTGTTTCTCAATCAGATTGG + Intronic
1188821330 X:34778967-34778989 GCTCAGATTTAGATTCAGATGGG + Intergenic
1189231048 X:39452696-39452718 GGTGTGCTTCAGGATTAGATGGG + Intergenic
1194989297 X:100528212-100528234 AGTCTGATTTAGAATCAAAATGG - Intergenic
1197627073 X:128814159-128814181 AGCCTGATTCAGTACCAGATAGG - Intergenic