ID: 1147434830

View in Genome Browser
Species Human (GRCh38)
Location 17:40404380-40404402
Sequence GAGATCTATCCCTTCTATGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147434830 Original CRISPR GAGATCTATCCCTTCTATGG TGG (reversed) Exonic