ID: 1147434830

View in Genome Browser
Species Human (GRCh38)
Location 17:40404380-40404402
Sequence GAGATCTATCCCTTCTATGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147434830 Original CRISPR GAGATCTATCCCTTCTATGG TGG (reversed) Exonic
903985604 1:27225759-27225781 CAGATCTAACTCTTCTAGGGGGG + Intergenic
907441072 1:54478760-54478782 GAGATCTCTCTCTTCTATAAAGG + Intergenic
908831518 1:68183417-68183439 AAGAACTATCCCTGCTATGATGG - Intronic
917050836 1:170920683-170920705 GAAAACTATCCCTTTTATGCAGG + Intergenic
921986715 1:221320123-221320145 GAAATCTATCCCTTGAGTGGGGG - Intergenic
1066031285 10:31428172-31428194 GAGATCTATCTTTTCGATGTGGG + Intronic
1074348936 10:112716085-112716107 CAGATCCATCCCTTCTGTGCTGG - Intronic
1076820598 10:132936881-132936903 GAGCTCTGTCCCCTCCATGGGGG - Intronic
1077787444 11:5399709-5399731 GAGATCTGACCCTTATCTGGCGG + Intronic
1079426875 11:20351996-20352018 TAGACCTCTCCCTTCTAGGGAGG - Intergenic
1085031760 11:73275402-73275424 GTGTCCTATCCCTTCTATTGAGG + Intronic
1086281975 11:85200551-85200573 GAGAACTACCCCATCTATGCAGG + Intronic
1094399045 12:30041405-30041427 AAGATTTAGCCCTTCCATGGTGG - Intergenic
1094482451 12:30895661-30895683 GAGTTCTACTCCTTATATGGAGG + Intergenic
1095032327 12:37306334-37306356 GAGCTCTAACAGTTCTATGGCGG + Intergenic
1099416471 12:82393332-82393354 GAGATCTTTAACTTCTTTGGTGG + Intronic
1106431876 13:29688340-29688362 GAGATCTAGCTCCACTATGGAGG + Intergenic
1107475768 13:40734305-40734327 GACTTCTGTCCCTTCTATGTTGG - Intronic
1115214764 14:31003499-31003521 TAGATTAATGCCTTCTATGGAGG + Intronic
1120009969 14:79402673-79402695 GAGATCTAATTCTTCAATGGTGG - Intronic
1121072678 14:91038853-91038875 GAGCTGTATACCTTCTGTGGTGG - Intronic
1122924045 14:104891724-104891746 GAGTTCTCTGCCTTCCATGGTGG + Intronic
1129663259 15:77565137-77565159 GTGATATTTCCCTTCTCTGGTGG - Intergenic
1131815182 15:96214730-96214752 GAGATTTGTCCCTCCTAAGGAGG - Intergenic
1138224962 16:55285217-55285239 GGGATCCTTCCCTTCTCTGGGGG - Intergenic
1138773312 16:59690252-59690274 GAAATTTATTCTTTCTATGGAGG + Intergenic
1145977427 17:28992546-28992568 GAAATATATCCCTTCTTTTGGGG - Intronic
1146448711 17:32954564-32954586 GAGATGTATCTCTTCTGTAGGGG - Intergenic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1156739072 18:40301805-40301827 GAGATCTATCTTTTCGATGGAGG + Intergenic
1160370109 18:78365011-78365033 GAGAAATATCCCTGCTATGATGG + Intergenic
1165643994 19:37417749-37417771 CACATTTTTCCCTTCTATGGTGG - Intronic
928398301 2:30959984-30960006 GAGCACTACCCCTTCTATGCAGG + Intronic
928426039 2:31178614-31178636 GAGTTCTATCCATGCTTTGGAGG + Intronic
930159704 2:48142298-48142320 GAGATATGTCCCTTCTATGCTGG + Intergenic
936515921 2:113181597-113181619 GAGATCTCTGCCTTCTAGGGAGG - Intronic
938222864 2:129587031-129587053 GAAAGCTTACCCTTCTATGGCGG + Intergenic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1177260215 21:18719912-18719934 GAGATCAATCCATTCTAGCGTGG + Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
955801813 3:62694531-62694553 GATTTCTGTCCCTTCTATGATGG - Intronic
956900304 3:73708492-73708514 GAGGACTATGCATTCTATGGTGG - Intergenic
959163959 3:102753599-102753621 GTGATGTATCACTTCTAGGGTGG + Intergenic
960964885 3:123097825-123097847 GAGAGTTATCCCTTCTTTGATGG + Intronic
962268837 3:133963254-133963276 CAGATCTACCCCATCTCTGGAGG - Intronic
962992960 3:140596319-140596341 GTGATCAATCACTTCTATGTTGG - Intergenic
973931945 4:55802313-55802335 GATATCTGTTCATTCTATGGGGG + Intergenic
992967446 5:82017566-82017588 AAGATATGTCCCTTCTATGCTGG + Intronic
1001049257 5:168401309-168401331 CAGATTTCTCCCTTCTAAGGGGG + Intronic
1002342699 5:178527279-178527301 GAGAGCTCTCCCTTCTGTGCTGG + Intronic
1004581371 6:16956950-16956972 GAGATGTATCCCATCAATGCCGG - Intergenic
1004836249 6:19535187-19535209 GAGATGTTTCCCTTCACTGGGGG - Intergenic
1004870204 6:19896623-19896645 GAGATGTTTCCTTTCTGTGGTGG + Intergenic
1005505474 6:26465574-26465596 GAGCTGTGTCCTTTCTATGGTGG - Intronic
1007754502 6:44090242-44090264 GAAATCTATCCCCTCCATGGTGG - Intergenic
1010732784 6:79408914-79408936 AAGAACTATTCCTTCTATGAAGG - Intergenic
1016210404 6:141525793-141525815 GAGATTTATTCCATCTATGCAGG + Intergenic
1035681959 8:1494850-1494872 GAGATCTAACTCTTCTGTGGCGG + Intergenic
1054785613 9:69207353-69207375 GAGATGCATCCCTTTTGTGGTGG + Intronic
1060745846 9:126130381-126130403 GACACCCATCCATTCTATGGGGG + Intergenic
1188224921 X:27585595-27585617 CAGAAATATCCCTTCTATAGAGG - Intergenic
1192051824 X:67731408-67731430 GAAATCCATCCATTCTAAGGTGG - Intergenic
1196858596 X:120006666-120006688 AAGATCTACCCTTTGTATGGGGG - Intergenic
1197756365 X:129998105-129998127 GTGAGCTATCCCTACTTTGGGGG - Intronic
1198439664 X:136650893-136650915 GAGATCTTTCCCTTTTACTGGGG + Intronic
1201038824 Y:9808990-9809012 TAGTTCTATCACTTCTATTGGGG + Intergenic