ID: 1147438257

View in Genome Browser
Species Human (GRCh38)
Location 17:40431159-40431181
Sequence TATATTTACACCCAAGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147438257_1147438260 8 Left 1147438257 17:40431159-40431181 CCCAGCACTTGGGTGTAAATATA No data
Right 1147438260 17:40431190-40431212 CTCTATAGTTAGAGACAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147438257 Original CRISPR TATATTTACACCCAAGTGCT GGG (reversed) Intergenic
No off target data available for this crispr