ID: 1147438622

View in Genome Browser
Species Human (GRCh38)
Location 17:40433187-40433209
Sequence ACAGTTTGTGCATCCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147438617_1147438622 14 Left 1147438617 17:40433150-40433172 CCTTGGCTCGGACTGCAGGACCA No data
Right 1147438622 17:40433187-40433209 ACAGTTTGTGCATCCCAAGCTGG No data
1147438618_1147438622 -6 Left 1147438618 17:40433170-40433192 CCAGTGCAGACTGCCCCACAGTT No data
Right 1147438622 17:40433187-40433209 ACAGTTTGTGCATCCCAAGCTGG No data
1147438616_1147438622 15 Left 1147438616 17:40433149-40433171 CCCTTGGCTCGGACTGCAGGACC No data
Right 1147438622 17:40433187-40433209 ACAGTTTGTGCATCCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147438622 Original CRISPR ACAGTTTGTGCATCCCAAGC TGG Intergenic
No off target data available for this crispr