ID: 1147440619

View in Genome Browser
Species Human (GRCh38)
Location 17:40444818-40444840
Sequence TAGGGAATAGAGAAGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 1, 2: 0, 3: 38, 4: 356}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147440609_1147440619 14 Left 1147440609 17:40444781-40444803 CCTAGCCGAGAGCTGCAGGAGCC 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1147440619 17:40444818-40444840 TAGGGAATAGAGAAGGGGCCAGG 0: 1
1: 1
2: 0
3: 38
4: 356
1147440615_1147440619 -7 Left 1147440615 17:40444802-40444824 CCTCATGTGTGTGGGATAGGGAA 0: 1
1: 0
2: 1
3: 10
4: 190
Right 1147440619 17:40444818-40444840 TAGGGAATAGAGAAGGGGCCAGG 0: 1
1: 1
2: 0
3: 38
4: 356
1147440610_1147440619 9 Left 1147440610 17:40444786-40444808 CCGAGAGCTGCAGGAGCCTCATG 0: 1
1: 0
2: 1
3: 27
4: 312
Right 1147440619 17:40444818-40444840 TAGGGAATAGAGAAGGGGCCAGG 0: 1
1: 1
2: 0
3: 38
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147440619 Original CRISPR TAGGGAATAGAGAAGGGGCC AGG Intronic
900391407 1:2435538-2435560 CAGGGACTGGGGAAGGGGCCAGG + Intronic
902649631 1:17828228-17828250 CAGGGAAAAGAGTGGGGGCCTGG + Intergenic
903049086 1:20587658-20587680 TGGGGAATGGGGAAGGGGCAGGG - Intergenic
903651092 1:24922845-24922867 CAGGGAATAGAGAAAGGGAGTGG - Intronic
904111172 1:28127653-28127675 TAGTGTATGGAGAAGGGGCATGG + Intergenic
904337258 1:29805983-29806005 TAGGGAATGGTGAAGGGTGCAGG + Intergenic
905029378 1:34871352-34871374 GAGGGAATGGACAAGGAGCCAGG - Intronic
906189681 1:43889178-43889200 TAGTGAATAAAGAAGGGAACAGG + Intronic
906615910 1:47232546-47232568 TTGGGATTAGAGATGGGGGCTGG - Intergenic
906703500 1:47877074-47877096 TAGGGAATAATGATGGGGACAGG + Intronic
907951387 1:59187183-59187205 TATGGAATAGAGAATGAGCAAGG + Intergenic
907974566 1:59418961-59418983 TATGGAAGCCAGAAGGGGCCTGG + Intronic
910758221 1:90712684-90712706 AAGGGGCCAGAGAAGGGGCCGGG - Intronic
910819890 1:91335165-91335187 TCAGGAATAGAGAAGTAGCCAGG + Intronic
912230085 1:107783303-107783325 TAGGGAACAGAGAAGGGGCCAGG + Intronic
913070092 1:115290685-115290707 TAAGAGATAGAGAAGGGGCAGGG - Intronic
913319959 1:117581385-117581407 TGAGGAAAAGAGAAGGGCCCAGG - Intergenic
914954830 1:152152263-152152285 TAGGAAATATAGAAGGAGACAGG - Intergenic
915592950 1:156880834-156880856 GAGTGATTGGAGAAGGGGCCTGG - Intronic
916078050 1:161214543-161214565 TGGGGAATAGAGAAGTGGAAAGG - Intergenic
916324198 1:163538906-163538928 AAGGGAATAAAGAAGGAGGCTGG + Intergenic
916511451 1:165475354-165475376 TTGGGGATAGAGAGTGGGCCAGG - Intergenic
918056256 1:181024041-181024063 CGAGGAATAAAGAAGGGGCCAGG + Intergenic
918141863 1:181726579-181726601 GGGGAAATAGAGAAAGGGCCAGG + Intronic
918187211 1:182138670-182138692 TAGGGCACAGAGAAGGTGGCAGG + Intergenic
920949937 1:210563174-210563196 GAGGGAATACAGAAGGGTACTGG + Intronic
921118835 1:212119225-212119247 TGAGGAAGAGAGATGGGGCCTGG + Intergenic
921333736 1:214065666-214065688 TAGGGAGTAGAGAGGAGTCCAGG - Intergenic
921348997 1:214216416-214216438 TGGGGAAGAGAGAAGAGACCAGG + Intergenic
921957767 1:221001724-221001746 TAAGGAAAAGAGAAGGGGAGTGG + Intergenic
922561341 1:226571934-226571956 TAAGGAAGGGAAAAGGGGCCGGG - Intronic
923096296 1:230777836-230777858 TAGGGAGATGAGAGGGGGCCAGG - Intronic
923501270 1:234566890-234566912 AATAGAACAGAGAAGGGGCCTGG + Intergenic
924086238 1:240454731-240454753 TTAGGGATAGAGAAGGGGCTGGG + Intronic
1063111085 10:3037980-3038002 TAAGAATAAGAGAAGGGGCCGGG + Intergenic
1063675590 10:8138515-8138537 CAGGGGACAGAGAAGGGGCCTGG - Intergenic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1069756338 10:70776290-70776312 CAGAGAATGGAGAAGGGCCCAGG - Intronic
1069929719 10:71874273-71874295 TGGGGAAAAGAGAAGGATCCCGG - Intergenic
1072594407 10:96857891-96857913 TAGGGAATAGGGACTGGGCAGGG - Intronic
1072788189 10:98298836-98298858 TAGGAGATGGTGAAGGGGCCTGG + Intergenic
1073111120 10:101063556-101063578 TAGGGATTAGTGAAGGGGAGCGG + Intronic
1074270180 10:111945586-111945608 TAGGGACTAGAGCAGATGCCCGG + Intergenic
1074617203 10:115081225-115081247 TAAGAAATACAGAAAGGGCCAGG - Intergenic
1075245420 10:120818077-120818099 AAGGAAAGAAAGAAGGGGCCAGG - Intergenic
1076389499 10:130087901-130087923 TGGAGAATAGAGAAGAGGCATGG + Intergenic
1076441394 10:130483606-130483628 AAGGGGATAGAGATGGGGTCTGG - Intergenic
1076921434 10:133456560-133456582 TAGGGAGGAGTGAAGGGGACGGG + Intergenic
1077116175 11:885595-885617 TTGGCTATAGAGAAGGGCCCAGG - Intronic
1078607384 11:12788925-12788947 TGGGGTTTAGAGATGGGGCCTGG + Intronic
1078670646 11:13362041-13362063 CAGGCAAGAGAGAAGGGGCCTGG + Intronic
1080301689 11:30791629-30791651 CAGGGAAAAGAGATGGGGCTGGG + Intergenic
1081212886 11:40357887-40357909 TAAAGATTAGAGAAGTGGCCAGG + Intronic
1081684007 11:45028657-45028679 ATGGGAAAAGAGAAGGGGCTTGG - Intergenic
1081701083 11:45153251-45153273 AAGGGAACTGAGAAGGAGCCAGG + Intronic
1081735333 11:45399563-45399585 AAGGTAAGAGAGAAGGGGCGTGG + Intergenic
1081949191 11:47028216-47028238 TAGAAAATAGAGATGTGGCCGGG - Intronic
1082061534 11:47865210-47865232 AAGGGAATGGAGAAGGGAACAGG - Intergenic
1083777001 11:64898906-64898928 AAAAGAATAGAGAAGGGGTCTGG - Intronic
1083894221 11:65612091-65612113 TAGGAAATGCAGGAGGGGCCAGG - Intronic
1088720463 11:112587815-112587837 TAGGGAAGAAAAAAGGGGCTAGG - Intergenic
1089515967 11:119031545-119031567 TTGGGGACAGAGACGGGGCCTGG + Intergenic
1090208082 11:124896706-124896728 TAAGGGAGAGAGAAGAGGCCTGG - Intronic
1091642446 12:2247620-2247642 TAGGGAACTGAGGAGGGACCAGG - Intronic
1095853979 12:46840743-46840765 TAGGAAATAGAGCAGTGGACAGG - Intergenic
1096092330 12:48911262-48911284 TTAGAAATAGAGATGGGGCCAGG + Intronic
1096210480 12:49761498-49761520 TAGAGAAAAGAGACTGGGCCAGG - Intronic
1097115067 12:56691024-56691046 TAGGGAATAAAAATTGGGCCGGG + Intergenic
1098460522 12:70728280-70728302 GAGAGATCAGAGAAGGGGCCTGG - Intronic
1098695067 12:73542145-73542167 TAAGGTATAAAGAAGGGGTCAGG - Intergenic
1098729163 12:74011161-74011183 TAGACAAGAGAGAAGGAGCCTGG + Intergenic
1098819331 12:75208626-75208648 TAGGGAGTAGAGAGGGGTCCGGG - Intronic
1099430280 12:82575162-82575184 GTGGGAACAGAGAAGGGACCTGG - Intergenic
1101157697 12:101943440-101943462 ACTGGAATAGAGAAGGAGCCTGG - Intronic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1102240491 12:111321810-111321832 AAGGGAATAGGCAAAGGGCCAGG + Intronic
1104390971 12:128390393-128390415 TGCAGAATAGGGAAGGGGCCAGG - Intronic
1105209545 13:18249807-18249829 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1106838337 13:33660066-33660088 GAGGGAGGAGAGAAGAGGCCAGG + Intergenic
1107704583 13:43088055-43088077 TAGTGAATATAGAAGGGGAGAGG + Intronic
1108688821 13:52845318-52845340 TGGGGAAGAGGGAAGGGGGCTGG + Intronic
1109120312 13:58448135-58448157 TAAGAAAAAGAGAAGAGGCCAGG - Intergenic
1110368691 13:74717352-74717374 TAGAGAATAGAGTAGTGGCCAGG + Intergenic
1110568623 13:76980432-76980454 GAGGGAAGAGAGAGGGCGCCAGG + Intergenic
1112086027 13:96033632-96033654 TTGGGAGCAGAGAAGAGGCCAGG - Intronic
1112430794 13:99348552-99348574 TTGGGAAGAGAGCAGAGGCCAGG + Intronic
1112920957 13:104612481-104612503 TAGGGAACAGTGATGGTGCCTGG - Intergenic
1114317346 14:21521425-21521447 TAAGGAAAATACAAGGGGCCAGG + Exonic
1116836047 14:49769639-49769661 TAGAAAATAGAAAGGGGGCCGGG + Intronic
1116867181 14:50040343-50040365 GATGGGATAGAGAAGGGGCATGG + Intergenic
1117125862 14:52625185-52625207 TAGAAAATAGAGGAGGGGGCTGG + Intronic
1117140936 14:52791025-52791047 ATGGGAGAAGAGAAGGGGCCTGG + Intronic
1118448125 14:65870347-65870369 TGTGGCATAGAGAAGGAGCCTGG - Intergenic
1119336698 14:73839437-73839459 GAAGGAATGGAGAATGGGCCAGG + Intergenic
1120357329 14:83451293-83451315 TAGGGTATAGTGAAAGGGCCAGG - Intergenic
1120763329 14:88305753-88305775 TAGAGAAAAGAGAAAGGGCTGGG + Intronic
1121260008 14:92559161-92559183 CAAGGAAGAGAGAAGGGGGCCGG - Intronic
1121371705 14:93364572-93364594 CAAGGAATAGAAAAGGGGCCTGG + Intronic
1121518303 14:94568557-94568579 TAGAAAATGGAGGAGGGGCCGGG + Intronic
1121593383 14:95137549-95137571 AAGGGAATGGAGAAGGGGAAGGG + Intronic
1121982500 14:98467275-98467297 TCTGGAACAGAGAAGGTGCCAGG + Intergenic
1122227336 14:100287365-100287387 AAGGGCAGAGAGAAGGGGGCAGG - Intergenic
1122672044 14:103379842-103379864 GAGGGGAAAGAGGAGGGGCCGGG - Intergenic
1122921552 14:104882439-104882461 GAGGGGAGAGAGGAGGGGCCAGG + Intronic
1126380631 15:48043165-48043187 TAGTGAATATAGAAGGAGCAGGG - Intergenic
1126600000 15:50418734-50418756 TAGGGAGGAGAGGCGGGGCCTGG - Intergenic
1127940173 15:63687242-63687264 TAAGAAATAGTGAGGGGGCCAGG + Intronic
1128213417 15:65917608-65917630 TAGGGAAGTGAGATGAGGCCCGG - Intronic
1129042429 15:72701094-72701116 TAGGGAATAAGGAGGCGGCCTGG - Intronic
1129673644 15:77620836-77620858 TAGGGGAGATGGAAGGGGCCTGG + Intronic
1130310566 15:82750339-82750361 TAGGGAGTGGAGAAAGGGCCGGG - Intergenic
1130956416 15:88630284-88630306 GAAGGAATTGAGAAGGGGGCGGG + Exonic
1131073784 15:89482230-89482252 TAATGCATAGAGAAGAGGCCAGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132291286 15:100705530-100705552 TAGGGAATAAAGAAGCAGCCAGG + Intergenic
1134052707 16:11147922-11147944 TAGGGAAGAGAAAGGGTGCCAGG - Intronic
1134132080 16:11656830-11656852 ACGTCAATAGAGAAGGGGCCAGG - Intergenic
1134566197 16:15253875-15253897 GAGAGAGGAGAGAAGGGGCCAGG + Intergenic
1134736298 16:16502823-16502845 GAGAGAGGAGAGAAGGGGCCAGG - Intergenic
1134882627 16:17758963-17758985 GAAGGAAAAGAGAAGGGGACTGG + Intergenic
1134931218 16:18209344-18209366 GAGAGAGGAGAGAAGGGGCCAGG + Intergenic
1136025547 16:27465953-27465975 TAGGGTGTGTAGAAGGGGCCTGG - Intronic
1136713441 16:32258623-32258645 GAGAGACTAGAGAAAGGGCCTGG - Intergenic
1136754470 16:32670808-32670830 GAGAGACTAGAGAAAGGGCCTGG + Intergenic
1136813643 16:33199557-33199579 GAGAGACTAGAGAAAGGGCCTGG - Intronic
1136820119 16:33309637-33309659 GAGAGACTAGAGAAAGGGCCTGG - Intergenic
1136826682 16:33366176-33366198 GAGAGACTAGAGAAAGGGCCTGG - Intergenic
1136831748 16:33464947-33464969 GAGAGACTAGAGAAAGGGCCTGG - Intergenic
1136989547 16:35143696-35143718 TAAGGAATGGCGACGGGGCCGGG - Intergenic
1137650854 16:50119082-50119104 AAAGAAATAGTGAAGGGGCCAGG + Intergenic
1137928115 16:52561142-52561164 AAGGAAACAGAAAAGGGGCCAGG - Intergenic
1138412324 16:56850440-56850462 CAGGGAGTGGAGAAGGGGCCTGG - Intergenic
1139424682 16:66872116-66872138 AAGGCAACAGAGAAGAGGCCAGG - Intronic
1141480107 16:84300672-84300694 TAAGAAAAGGAGAAGGGGCCAGG + Intronic
1142147712 16:88499491-88499513 TTGGGAGCAGCGAAGGGGCCAGG + Intronic
1202992219 16_KI270728v1_random:22531-22553 GAGAGACTAGAGAAAGGGCCTGG - Intergenic
1203056617 16_KI270728v1_random:931139-931161 GAGAGACTAGAGAAAGGGCCTGG + Intergenic
1142792524 17:2278881-2278903 TAGAGAAGATAGCAGGGGCCAGG - Intronic
1143347535 17:6261019-6261041 TGGGGTTTAGAGAAGGGGTCAGG - Intergenic
1145938873 17:28730955-28730977 AAGGAAAGAAAGAAGGGGCCGGG + Intronic
1146672486 17:34751162-34751184 CAGGTAATAGAGAAAGGCCCTGG + Intergenic
1147440619 17:40444818-40444840 TAGGGAATAGAGAAGGGGCCAGG + Intronic
1151101572 17:71562013-71562035 TAGGAACAAGAGAGGGGGCCAGG + Intergenic
1151309334 17:73283856-73283878 CAGGCAAGAGAGGAGGGGCCGGG + Exonic
1151872296 17:76844592-76844614 TGGGGAAGAGAGAAGGGGGACGG + Intergenic
1152210271 17:78999379-78999401 TTGGGACTAGAAAAGGGGCAGGG - Intronic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1153224404 18:2887527-2887549 GAGGGAAGGGAGAAGGTGCCAGG - Intronic
1154387199 18:13904862-13904884 TAAGGTATAAGGAAGGGGCCCGG - Intronic
1157811807 18:50702663-50702685 AAGGAAACAGAAAAGGGGCCAGG - Intronic
1157930707 18:51820184-51820206 TAGTGAATAGAGATCAGGCCAGG - Intergenic
1158539028 18:58335943-58335965 TACAGAAAAGAGAAGGGCCCTGG - Intronic
1160364423 18:78312357-78312379 AAAGAAATTGAGAAGGGGCCAGG + Intergenic
1161504988 19:4639238-4639260 TCCGGAATCGCGAAGGGGCCCGG - Intergenic
1161785130 19:6319814-6319836 TAAATAATACAGAAGGGGCCAGG + Intronic
1162801475 19:13113049-13113071 TAGGGGACAGAGAAGGTACCTGG - Intronic
1163547532 19:17948677-17948699 TAGGGAGTAGAGAAGGGATATGG + Intergenic
1164525072 19:29007602-29007624 TAAGGAATAGAGGAGGGTGCGGG + Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1164766671 19:30777598-30777620 TAGGGAGAAGGGAAGGTGCCAGG + Intergenic
1164946297 19:32295860-32295882 TGTGGAATAGAAAAGTGGCCAGG - Intergenic
1165120178 19:33553777-33553799 TAGGGAAGTGAGGAGGGGCTAGG + Intergenic
1165784122 19:38451193-38451215 AAGGGCGTAGAGACGGGGCCTGG + Intronic
1166661660 19:44651161-44651183 TAGAAAATGGACAAGGGGCCAGG - Intronic
1166812319 19:45522009-45522031 TAGGGAACCAAGAAGGGGGCTGG - Intronic
1167212015 19:48139384-48139406 TAGAGAAGAGAGAAGAGGGCAGG - Intronic
1168268263 19:55235299-55235321 TAGAGAAGAGAGAAGCTGCCTGG + Intronic
1168541868 19:57219482-57219504 GAGGGAAATGAGAAGGGGCGAGG - Exonic
925378521 2:3406655-3406677 TTGGGAACAGAGCATGGGCCAGG - Intronic
925379686 2:3416587-3416609 GAGGGCATAGTGAAGGGGCAGGG - Intronic
925587192 2:5475545-5475567 GAGGGAGAGGAGAAGGGGCCTGG + Intergenic
926679982 2:15655581-15655603 TAGGGAGGAGGGTAGGGGCCGGG + Intergenic
926942543 2:18153659-18153681 ATTGGAATATAGAAGGGGCCAGG + Intronic
928154058 2:28859598-28859620 GAGGGAATAGAGAAGGAGAGGGG - Intronic
928325608 2:30317245-30317267 TAGGGAAGAGAAAGGGGTCCTGG - Intronic
928934769 2:36664048-36664070 TAGGGAACAGAGGAGGGTCGGGG - Intergenic
929489085 2:42380623-42380645 TTGGGAAGAGAGATGGGGTCAGG + Intronic
930251087 2:49034718-49034740 AAGGGAATACAGAATGGGGCAGG - Intronic
931995078 2:67831867-67831889 TATGAAACAGAGAAGAGGCCAGG - Intergenic
932529638 2:72515185-72515207 AAGGGAAAAGAGAAGGTCCCAGG + Intronic
932843932 2:75115609-75115631 AAAAGAATAGAGAAGAGGCCGGG + Intronic
936893763 2:117403686-117403708 AATGTAATAAAGAAGGGGCCAGG + Intergenic
936972276 2:118186892-118186914 TAGGGGAGAGAAAAGTGGCCTGG - Intergenic
937333078 2:121044236-121044258 AAGGGAAGAGGGAAGGGGCAGGG + Intergenic
939189593 2:138901370-138901392 TAGGGAGGAGAGGAGGGGCCTGG + Intergenic
939914210 2:148020493-148020515 TTGGGAATTGGGAAGGGGGCAGG - Intronic
940880735 2:158944232-158944254 TGTGGAATAGGGAAGGGACCAGG - Intergenic
942616375 2:177795512-177795534 TAGGGCATGGAGAAGGGGGTGGG + Intronic
944031797 2:195243137-195243159 TGGGGAAGAAAGGAGGGGCCTGG + Intergenic
944694342 2:202187600-202187622 TAGGAATTAGAAATGGGGCCAGG - Intronic
944929490 2:204501703-204501725 AAGAAAATAGAGAAGGGGTCAGG - Intergenic
945532207 2:210969809-210969831 GAAGAAAGAGAGAAGGGGCCGGG - Intergenic
946248558 2:218400197-218400219 GTGGGAGGAGAGAAGGGGCCGGG + Intronic
946695482 2:222353903-222353925 TAGGGAGAAGAGAAAGAGCCGGG + Intergenic
947651181 2:231787148-231787170 AAGGGAAAAGAGAAGGGGAGAGG - Intronic
1169901529 20:10557659-10557681 AAGGGAATGGAGAACAGGCCTGG - Intronic
1170788896 20:19491638-19491660 TTGGGAACAGAGGAGGGGCAGGG - Intronic
1171290700 20:23981474-23981496 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1172356080 20:34280971-34280993 TAGGGAGGAGAGGTGGGGCCTGG + Exonic
1172665429 20:36596069-36596091 AAGGGTATAGAGAGGCGGCCAGG - Intronic
1174180712 20:48672622-48672644 TGGGGAGCAGAGAGGGGGCCAGG - Intronic
1174513380 20:51072908-51072930 TGGGTAATAGGGCAGGGGCCTGG + Intergenic
1175171974 20:57087074-57087096 AAGGGAATGGGGAAGGGGTCGGG - Intergenic
1175892714 20:62322596-62322618 TAGGGACTAGAGTTGGGGCCTGG - Intronic
1175922203 20:62455544-62455566 CAGGGTGCAGAGAAGGGGCCTGG - Intergenic
1176040186 20:63061039-63061061 TAGGCACCAGAGGAGGGGCCAGG - Intergenic
1180665350 22:17506420-17506442 AAGGAAGTAGAGAGGGGGCCAGG - Intronic
1180766721 22:18349593-18349615 TAGGGGATAGAGATGGGAGCTGG + Intergenic
1180779593 22:18512785-18512807 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1180812308 22:18770106-18770128 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1181134412 22:20754382-20754404 TAAAGAATAGAGAAAGGGACTGG - Intronic
1181198465 22:21204353-21204375 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1181648263 22:24245445-24245467 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1181703241 22:24632528-24632550 TAGGGGATAGAGATGGGAGCTGG + Intergenic
1182158465 22:28098258-28098280 GAGGAAATAGACAAGAGGCCAGG + Intronic
1182329778 22:29543040-29543062 AAGGGAATAAAGAAGGGGATGGG + Intronic
1182841949 22:33398251-33398273 TTGGGGATAGAGATGGGGCATGG - Intronic
1183731639 22:39621801-39621823 TAGGGCAGTGGGAAGGGGCCAGG - Intronic
1183959225 22:41401158-41401180 TAGAAAATACAGAGGGGGCCAGG - Intergenic
1185294208 22:50045434-50045456 TGGGGACTGGAGATGGGGCCAGG + Intronic
1203228340 22_KI270731v1_random:90484-90506 TAGGGGATAGAGATGGGAGCTGG + Intergenic
949896414 3:8770139-8770161 TTTAGAATAGAGAAGGGGCAGGG - Intronic
950154133 3:10709109-10709131 TAGGAAGGAGAGAGGGGGCCAGG + Intergenic
950217525 3:11169908-11169930 TGGGGCATGGAGAAGGGGCATGG - Intronic
953055444 3:39383940-39383962 AAGGGAATTGAGAAGGGGGCAGG + Intronic
953913584 3:46904772-46904794 TAGGGCATAGGGGAGGGGTCAGG + Intergenic
954359148 3:50109366-50109388 TAAGAAAAAGAGAAGAGGCCGGG - Intronic
954848510 3:53580401-53580423 CAGCGAATAGAGAAAGTGCCTGG + Intronic
957512061 3:81201781-81201803 CAGTGAAGAGAGAAGGGGCAGGG + Intergenic
958832829 3:99110338-99110360 TATGGAATAAGGAAGGGGCATGG - Intergenic
959925421 3:111915846-111915868 TAGGGAAGAAAGTAGGGGCAGGG + Intronic
962674175 3:137741551-137741573 TAGTGAAAAGAGAAGAGGCTAGG + Intergenic
962887059 3:139637597-139637619 TAAGGAATAGAGAAGGTGGGTGG - Intronic
963261702 3:143198319-143198341 TATTGACTAGAGAAGGGGCTGGG + Intergenic
963836268 3:150060925-150060947 TTGGAAATAGAGAAGGAGGCTGG - Intergenic
965120876 3:164554654-164554676 TATGGTATAGAGTACGGGCCAGG - Intergenic
965529434 3:169756531-169756553 TGAGGAGGAGAGAAGGGGCCAGG + Intergenic
966941180 3:184748409-184748431 GAGTGAAAAGAGAAGGGGTCAGG - Intergenic
967263449 3:187668996-187669018 TAGGGAAGAGAGATGGGGTGTGG + Exonic
967952238 3:194850343-194850365 AAGGGCATAAAAAAGGGGCCAGG + Intergenic
968109504 3:196032815-196032837 TAGGGCATAAAAAAGTGGCCAGG + Intronic
968754018 4:2405593-2405615 TAGGTCAGAGGGAAGGGGCCGGG + Intronic
970213512 4:13734909-13734931 TTGGGAAAAGAGATGGTGCCTGG + Intergenic
971169361 4:24217482-24217504 TGGGGACAAGAGAAGGGGCCTGG + Intergenic
971394164 4:26213418-26213440 TAGGAAAATGAGAAGGGGTCAGG + Intronic
972092028 4:35298841-35298863 CAGGGAATTGAGAAGCAGCCAGG - Intergenic
974000739 4:56508281-56508303 AAGGGAATGGAGAAGAGGCAGGG + Intronic
974056480 4:56988162-56988184 CAGGGTTTGGAGAAGGGGCCGGG + Intronic
975487299 4:74948548-74948570 TAGGGAAGAGGGAAGTGGGCTGG + Intronic
979085433 4:116404287-116404309 TAGGGAATACAGAAGGAGAGAGG + Intergenic
979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG + Intergenic
981452043 4:144909826-144909848 TAGGAAATATGGAAGGGGCAGGG + Intergenic
984245837 4:177274661-177274683 TAAAGAATAAAAAAGGGGCCAGG + Intergenic
984590262 4:181609120-181609142 TAGGGAGTAAGGCAGGGGCCAGG + Intergenic
985557974 5:567231-567253 TGGGGAAAATAGAACGGGCCTGG + Intergenic
987114449 5:14714874-14714896 TAGTGACCAGAGGAGGGGCCTGG - Intronic
987138610 5:14922456-14922478 TAGGGAACAGAGAGTGGGCCAGG + Intergenic
987795929 5:22626415-22626437 TAGGGAATAAAGCTGGGGCCTGG + Intronic
988489999 5:31698197-31698219 TAAGAAATAAGGAAGGGGCCGGG - Intronic
988491674 5:31710520-31710542 TAAGGAATAGAGATATGGCCAGG + Intronic
988941132 5:36149468-36149490 TGTGGACTATAGAAGGGGCCTGG - Intronic
990420334 5:55625612-55625634 CGGCGAACAGAGAAGGGGCCAGG - Intergenic
990703236 5:58498001-58498023 GAGGAAATAGAGAAAGAGCCTGG - Intergenic
992080436 5:73231016-73231038 TAGACAATTGAGAAGGGGGCTGG - Intergenic
995748894 5:115433084-115433106 AAGGCAATAGGGAAGGGCCCTGG - Intergenic
997608360 5:135192598-135192620 TAGGGGAGAGAGAAGGTGTCTGG - Intronic
998115405 5:139533353-139533375 AAAGGAAAAGAAAAGGGGCCGGG + Intronic
998507383 5:142682932-142682954 CAGGTAACAGAGAATGGGCCTGG - Intronic
998675275 5:144400957-144400979 TGGGGAATAGAGAAAAGGCCAGG + Intronic
1000119278 5:158181029-158181051 AAGGATATAGAGAGGGGGCCAGG + Intergenic
1000152154 5:158513857-158513879 GAGGGAATAGAGAGAGGGACAGG + Intergenic
1002207885 5:177576566-177576588 TAGGGAATAGAGTAAGGGTTTGG - Intergenic
1003239177 6:4327819-4327841 TAGGGAATAGAAACTAGGCCTGG + Intergenic
1003883545 6:10500095-10500117 TAGAAAATAGAGACGGGGCCAGG + Intronic
1004502344 6:16220137-16220159 TAGGAACTAGAGTGGGGGCCGGG + Intergenic
1006133254 6:31881149-31881171 TTGTGAAGAGAGATGGGGCCTGG - Intronic
1006205583 6:32338843-32338865 TAGGGAATAAACAAGGGGAAAGG + Intronic
1006445947 6:34079886-34079908 CAGGGAATAGAGTGGGGCCCTGG - Intronic
1007610766 6:43147391-43147413 GAGGGAAGGAAGAAGGGGCCGGG - Intronic
1007683102 6:43647972-43647994 TAGAGAATACAGGATGGGCCGGG + Intronic
1007725859 6:43915227-43915249 TGGGGAATAGAGAGGTGGCTGGG - Intergenic
1009242621 6:61200051-61200073 CAGGAAATAGAGAATGGTCCAGG - Intergenic
1009514533 6:64598163-64598185 AAGAAAAAAGAGAAGGGGCCAGG + Intronic
1011091919 6:83612578-83612600 TAAAGAAAAGAGAAGAGGCCAGG + Intronic
1011884029 6:92070430-92070452 TAGGAATGAGAGAAGGAGCCTGG - Intergenic
1013052608 6:106551135-106551157 TGGGGACTACAAAAGGGGCCAGG - Intronic
1013066131 6:106685898-106685920 TGGGGAATATATGAGGGGCCTGG + Intergenic
1013394260 6:109718638-109718660 AAAGGCATAGAAAAGGGGCCAGG - Intronic
1014098042 6:117481828-117481850 TAGTGTACAGAGTAGGGGCCAGG - Intronic
1014222001 6:118807121-118807143 GTGGGAATAGAAAAGGGCCCTGG + Intergenic
1014348543 6:120308773-120308795 TAAAAAATAGAGGAGGGGCCGGG - Intergenic
1014483780 6:121973466-121973488 AATGGAATAGAGAAGGGAACTGG - Intergenic
1017082629 6:150683853-150683875 ATGGGAATATTGAAGGGGCCTGG + Intronic
1019342880 7:516916-516938 CAGGGATTACAGAGGGGGCCGGG + Intronic
1019356801 7:584426-584448 CAGGGAATGGGGAAGAGGCCGGG + Intronic
1020728202 7:11843736-11843758 TAGAAAAGAGAGAAGGGGGCAGG - Intergenic
1022021949 7:26408513-26408535 TAGCATATAGAGAAGAGGCCGGG + Intergenic
1022500190 7:30877973-30877995 TAAAGAAGAGGGAAGGGGCCAGG - Intronic
1022515162 7:30970599-30970621 AAGGGAAGGGAGCAGGGGCCTGG - Intronic
1022728558 7:33002426-33002448 TAAGGAATAGAATAGAGGCCAGG - Intronic
1023022067 7:36019444-36019466 AAGGGAATAGACCAGGGGCCGGG + Intergenic
1023224846 7:37958653-37958675 TATGGATTAGAGCAGGGTCCTGG + Intronic
1024540133 7:50469321-50469343 TAGTGCATAGAGAAGGTGTCTGG + Intronic
1024890174 7:54191079-54191101 CAGGGAGGAGAGAGGGGGCCAGG + Intergenic
1025045091 7:55685563-55685585 TAAGGAATAGAATAGAGGCCAGG + Intergenic
1025255293 7:57380822-57380844 AAAGGAAGAGAGCAGGGGCCTGG - Intergenic
1025986904 7:66461807-66461829 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1026559076 7:71433098-71433120 TAAAGAATAGAGATGGGGCCAGG - Intronic
1026775335 7:73227522-73227544 CAGGGAATGGAGCAGGGGCTGGG + Intergenic
1027016192 7:74780893-74780915 CAGGGAATGGAGCAGGGGCTGGG + Intronic
1027071836 7:75165044-75165066 CAGGGAATGGAGCAGGGGCTGGG - Intergenic
1027159400 7:75791408-75791430 GAGGGAAGAGAGCAGGAGCCAGG - Intergenic
1027210174 7:76140644-76140666 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1029330126 7:99846070-99846092 TATGGAAAGGAAAAGGGGCCAGG - Intronic
1029462395 7:100703544-100703566 TAGGGAACTGAGAAGGGCCTGGG + Intergenic
1029644550 7:101845546-101845568 GAGGGAATAGAGGAGGAGGCTGG + Intronic
1029654741 7:101916864-101916886 AAGGGAAGGAAGAAGGGGCCAGG - Intronic
1031111679 7:117618126-117618148 TCTGAAAGAGAGAAGGGGCCAGG - Intronic
1031642552 7:124182235-124182257 TAGGCAAGAGAGAAGGGGGTGGG + Intergenic
1032183930 7:129706837-129706859 TAGGGAATATAGAGGGTTCCAGG + Intronic
1032238212 7:130141988-130142010 TGGAGAATTGAGCAGGGGCCTGG + Intergenic
1032308289 7:130757123-130757145 TATGGGAGAGAGAAGGGCCCCGG - Intergenic
1033354461 7:140588355-140588377 TAGAAAATAGAAAAGGGGGCCGG + Intronic
1034746326 7:153526972-153526994 GAGGGAATAGAGAAGTGGCGGGG + Intergenic
1035138284 7:156729767-156729789 TTGGGAAAATAGAAGGGGGCTGG - Intronic
1035357491 7:158285287-158285309 TAGGGACAGGAGAAGGTGCCAGG + Intronic
1035584454 8:761166-761188 GGGGGAGCAGAGAAGGGGCCTGG - Intergenic
1036071948 8:5450527-5450549 TAGGGAATGGAGAATGGGTGGGG - Intergenic
1037288248 8:17323549-17323571 TAGGCACTAGAGAGGAGGCCAGG + Intronic
1037930673 8:22878274-22878296 TAGAGAATATAGTAGGGGACTGG + Intronic
1038257468 8:25963339-25963361 TAGGGATTAAAGAAGAGGGCAGG - Intronic
1041396120 8:57393460-57393482 CAGGGAATAGGTAAGTGGCCAGG + Intergenic
1041578848 8:59433481-59433503 TAGGGAATAGGGTGGGGGCTAGG - Intergenic
1044520873 8:93197950-93197972 TAAGGAATAGAAAAGGGACAAGG - Intergenic
1044527495 8:93267969-93267991 TAAGAAATAGAAAAGAGGCCAGG - Intergenic
1044987447 8:97767911-97767933 TTTGTAATAGAGACGGGGCCAGG - Intergenic
1045671885 8:104564525-104564547 TAGGGATGAGAGTAGGGGACAGG + Intronic
1045742336 8:105375959-105375981 TAGGGCATAGAGAAGTGGGGTGG - Intronic
1046644957 8:116776082-116776104 CAGGGTATGGGGAAGGGGCCAGG - Intronic
1047020586 8:120771201-120771223 TTGGGAAAAGAGAAAGGTCCAGG + Intronic
1048504761 8:135011069-135011091 TTAGTAATAGAGAAGGGGCTAGG + Intergenic
1049426646 8:142540810-142540832 TAGGGACGAGGGAAGGGGCGGGG + Intronic
1049693496 8:143972898-143972920 TAGTGAACAGAGAAGGGGTGTGG + Intronic
1052028660 9:23603842-23603864 TGGGGAAGAGCGAAGGGGCGGGG - Intergenic
1053204196 9:36172615-36172637 TAGGGGATAGGGAGGTGGCCAGG - Intergenic
1055365694 9:75542353-75542375 TGGGGAAGAGAGAAGGGGTGGGG + Intergenic
1055372606 9:75616492-75616514 CAGGCAGTAGAGAAGGGGCTTGG + Intergenic
1056603073 9:88061630-88061652 TAAGGAGTAGGGAAGGGGCCAGG - Intergenic
1056637393 9:88342600-88342622 AAGGAAATAGAGAAGTAGCCTGG - Intergenic
1057194300 9:93108222-93108244 TGGGGAACAGATAATGGGCCCGG + Intronic
1060445152 9:123680845-123680867 TATGGAAGAGAGCAGGGGACAGG + Intronic
1061021913 9:128021261-128021283 TAGAGAATATATAAAGGGCCTGG + Intergenic
1061035709 9:128113288-128113310 AAAGAAATAGAGAAGGGGCCAGG + Intergenic
1062209064 9:135353416-135353438 AAGGGAAGACAGACGGGGCCAGG + Intergenic
1062246940 9:135573947-135573969 TGGGGAATAGAGAAATGGCAGGG + Intergenic
1062422237 9:136488353-136488375 TAGGGAAGAGAAAAGGGCCCGGG + Intergenic
1186725845 X:12357892-12357914 CAGGGAATAGAGATGGGAACAGG - Intronic
1187188304 X:17009111-17009133 TAGAGAAGAGAGGAGGGGCTAGG - Intronic
1187315556 X:18190568-18190590 TATGGAATAAAGATGAGGCCAGG + Intronic
1187761340 X:22589390-22589412 TAGAGAAGAGAAAAGGGGCAGGG + Intergenic
1188013928 X:25086861-25086883 AAGGGCATAGAGTAGGGGCCAGG + Intergenic
1190842117 X:54154903-54154925 GACAGAAAAGAGAAGGGGCCGGG + Intronic
1193844447 X:86451235-86451257 TATGGTATAAGGAAGGGGCCTGG + Intronic
1193893188 X:87077529-87077551 AAGGGAAAAGAGAAGGGGAGAGG + Intergenic
1195302302 X:103542634-103542656 TAGAGAAAAGAGGAGGTGCCTGG - Intergenic
1196098481 X:111824562-111824584 TTGGGCCTAGAGGAGGGGCCTGG + Intronic
1196402905 X:115334511-115334533 TAAGAAATAGTTAAGGGGCCGGG + Intergenic
1198012877 X:132577005-132577027 GAGGGAATAGAGAATTTGCCTGG - Intergenic
1198875197 X:141217208-141217230 TAAGAAACACAGAAGGGGCCGGG + Intergenic
1199583744 X:149389066-149389088 TGGGGAATAGGGACGGGGACGGG + Intergenic
1199716459 X:150510462-150510484 TAGGGAATGGAAAAGGGGTTGGG + Intronic
1200685516 Y:6254958-6254980 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1200687907 Y:6273567-6273589 GAGAGAACAGAGAAGAGGCCAGG - Intergenic
1200951067 Y:8901165-8901187 GAGGGAACAGAGAGGAGGCCAGG - Intergenic
1200954305 Y:8929220-8929242 GAGGGAACAGAGAGGAGGCCAGG - Intergenic
1200958100 Y:8971546-8971568 GAGGGAACAGAGAGGAGGCCAGG - Intergenic
1200986195 Y:9305060-9305082 GAGGGAACAGAGAGGAGGCCAGG + Intergenic
1200991046 Y:9346199-9346221 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1200993704 Y:9366492-9366514 GAGGGAAGAGAGAAGAGGCCAGG - Intronic
1200996367 Y:9386810-9386832 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1200998882 Y:9455365-9455387 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1201001536 Y:9475674-9475696 GAGGGAACAGAGAAGAGGCCAGG - Intronic
1201004202 Y:9495976-9495998 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1201006857 Y:9516288-9516310 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1201009509 Y:9536594-9536616 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1201012100 Y:9557296-9557318 GAGGGAACAGAGAAGAGGCCAGG - Intergenic
1201047362 Y:9901135-9901157 GAGGGAACAGAGAAGAGGCCAGG + Intergenic
1201352281 Y:13057030-13057052 TATGGTATAAAGAAGGGGACCGG + Intergenic
1202110176 Y:21409430-21409452 GAGGGAACAGAGAGGAGGCCAGG + Intergenic
1202115133 Y:21464990-21465012 GAGGGAACAGAGAGGAGGCCAGG - Intergenic
1202124387 Y:21555841-21555863 GAGGGAACAGAGAGGAGGCCAGG - Intergenic
1202131979 Y:21621043-21621065 GAGGGAACAGAGAAGAGGCCAGG + Intergenic
1202154621 Y:21873539-21873561 GAGGGAACAGAGAGGAGGCCAGG + Intergenic
1202195599 Y:22296250-22296272 GAGGGAACAGAGAGGAGGCCAGG + Intergenic
1202196729 Y:22305656-22305678 GAGGGAACAGAGAAGAGGCCAGG - Intergenic