ID: 1147441258

View in Genome Browser
Species Human (GRCh38)
Location 17:40448571-40448593
Sequence CCACCTGGTGCTACTCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147441258_1147441264 27 Left 1147441258 17:40448571-40448593 CCAGGATGAGTAGCACCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1147441264 17:40448621-40448643 AGCAAGTATTTAGCCAGTTTTGG 0: 1
1: 0
2: 0
3: 10
4: 158
1147441258_1147441263 0 Left 1147441258 17:40448571-40448593 CCAGGATGAGTAGCACCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1147441263 17:40448594-40448616 CTGGAACTCTTGTGTGAGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 181
1147441258_1147441262 -1 Left 1147441258 17:40448571-40448593 CCAGGATGAGTAGCACCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1147441262 17:40448593-40448615 GCTGGAACTCTTGTGTGAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147441258 Original CRISPR CCACCTGGTGCTACTCATCC TGG (reversed) Intronic
900072120 1:779155-779177 CTACCTGGCGCCGCTCATCCTGG + Intergenic
904642366 1:31939986-31940008 CCACCTGGTGGTGAACATCCTGG - Intronic
907529998 1:55085501-55085523 CCAAATAGTGCTATTCATCCAGG - Intronic
916764865 1:167850544-167850566 CTACCTGGGTCTACTCCTCCTGG - Intronic
919846629 1:201647084-201647106 CCACCTGGGCCTACCCCTCCTGG + Intronic
920896292 1:210053305-210053327 CCACCTGTTGCTTCTCAACTTGG - Intronic
921806843 1:219464784-219464806 ACACATTGTGCTACTAATCCAGG - Intergenic
921830614 1:219724194-219724216 ACACCTTGTGCTCCTAATCCAGG - Intronic
922194231 1:223345928-223345950 TCACCTGGAGCTCCTCCTCCTGG + Intronic
922267056 1:223993110-223993132 CTACCTGGCGCCGCTCATCCTGG + Intergenic
1063355585 10:5395528-5395550 CCACCTGCTGCTAGTCCTCCTGG + Intronic
1063413588 10:5855346-5855368 TCACCTGGTGCTACTCAGCCTGG + Intergenic
1066726645 10:38402484-38402506 CTATCTGGCGCTGCTCATCCTGG - Intergenic
1070305176 10:75235288-75235310 CAACCTGGCGCGGCTCATCCAGG - Exonic
1070588071 10:77781079-77781101 CCACCTGGACCTGCTCACCCAGG - Intergenic
1074031963 10:109697671-109697693 CCACCTGGTCCTGCTAATACTGG + Intergenic
1074885764 10:117691939-117691961 GCATTTGCTGCTACTCATCCAGG + Intergenic
1075235083 10:120720486-120720508 CCACCTGCTGTTTCTCACCCAGG - Intergenic
1076526149 10:131113429-131113451 GCACCAGATGTTACTCATCCGGG + Intronic
1077184868 11:1231496-1231518 GCAGCTGGTGCCACTCATGCAGG + Exonic
1078068089 11:8090964-8090986 CCTGCTGGTGCTAGTAATCCAGG + Intronic
1082283618 11:50298094-50298116 CTACCTGGCGCCACTCATCCTGG - Intergenic
1083486184 11:62984295-62984317 GCACCTGGGGCTCCCCATCCAGG - Intronic
1083622526 11:64056217-64056239 CCACCTGCTGCAGCTCCTCCAGG - Intronic
1084320641 11:68371692-68371714 CTACCTGGAGCTGCTCACCCAGG + Intronic
1084720343 11:70901758-70901780 CCACCAGGTGCTCCTTCTCCGGG - Intronic
1084934024 11:72577443-72577465 GCACCTCGTACTCCTCATCCAGG + Exonic
1085455134 11:76661280-76661302 CCACCTGGAGCACCTCAGCCTGG - Exonic
1088881884 11:113979229-113979251 GCACCTGATTCTTCTCATCCTGG - Exonic
1090437082 11:126695964-126695986 CCACCTCGCCCGACTCATCCAGG - Intronic
1103739041 12:123078861-123078883 CCACCTGGCCCCACTCATACTGG + Intronic
1105551059 13:21396155-21396177 CCACGTGGTGCTTCCTATCCTGG + Intronic
1115522403 14:34246143-34246165 CAACCTGCTGCTTCTCCTCCTGG - Intronic
1117252286 14:53950082-53950104 CCACCTTATCATACTCATCCAGG + Exonic
1125657184 15:41367584-41367606 ACACCTTGTGCTCCTAATCCAGG + Intronic
1125723584 15:41856849-41856871 ACACCTGGTGCTGCTCCTGCAGG + Exonic
1128762226 15:70225133-70225155 ACACCTGGTGCTACTGTTCTAGG + Intergenic
1129672459 15:77614808-77614830 CAACCTGGAGACACTCATCCTGG - Exonic
1131389386 15:92034594-92034616 CCACCTGGTCCTGCCCACCCTGG - Intronic
1131653192 15:94424532-94424554 CCTCCAGGTGCTTCTCATACAGG + Intronic
1132084183 15:98893061-98893083 CCCCCTGGTGCTAATCATGAAGG - Intronic
1132585042 16:702431-702453 CCACCTGGTGTCTCTCCTCCTGG + Intronic
1132618650 16:854319-854341 CCACCTGGGGCCCCACATCCAGG - Exonic
1134217328 16:12326382-12326404 CCACCTGGTTCAACCCTTCCAGG - Intronic
1138282773 16:55784655-55784677 CCACCTGGATCTCTTCATCCTGG + Intergenic
1142395643 16:89829689-89829711 TCACCAGGTCCTGCTCATCCTGG + Intronic
1144814076 17:18021119-18021141 TCACCTGGTACTCCTCCTCCAGG + Exonic
1146054072 17:29572585-29572607 CCTGCTGGTGCTGCTCACCCTGG + Exonic
1146205291 17:30899432-30899454 GCACCTGATGCTGCCCATCCTGG + Exonic
1147441258 17:40448571-40448593 CCACCTGGTGCTACTCATCCTGG - Intronic
1147918345 17:43901541-43901563 CGACCTGGTGCCACTCCTCAGGG - Intronic
1148247601 17:46044808-46044830 CCAACTGCTGCTTTTCATCCTGG - Intronic
1152940021 17:83164100-83164122 GCTCCTGTTGCTACACATCCTGG + Intergenic
1156309474 18:35909005-35909027 CCACCCTGGGCTACACATCCAGG + Intergenic
1158872972 18:61706777-61706799 GCACCTGGTGCTTTTCAACCAGG + Intergenic
1160765242 19:804684-804706 TCACCTGGTGCAGCACATCCAGG - Exonic
1161770314 19:6227319-6227341 CCACCTGGTCCCAGCCATCCTGG - Intronic
1162419396 19:10557638-10557660 CCAGCCGGTAATACTCATCCAGG + Exonic
1163123803 19:15233334-15233356 CCGCCTGGTGCTACCCACCCAGG + Intronic
1165360119 19:35331309-35331331 CTCTCTGGTGCTACTCATCAAGG - Intronic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1167647146 19:50711931-50711953 CCACCAGGTGCTCCTGATTCAGG - Exonic
1167712878 19:51123187-51123209 TCACCTGGAGCTACTACTCCAGG + Intergenic
1167715199 19:51138435-51138457 TCACCTGGGGCTACTACTCCAGG + Intergenic
1168467349 19:56613850-56613872 CCAGCTGCTGCCACTCCTCCTGG - Intronic
926932884 2:18057744-18057766 CCACATGCTGGAACTCATCCTGG - Intronic
931700042 2:64902037-64902059 CCTCCAGGTGATTCTCATCCAGG - Intergenic
931771553 2:65502095-65502117 CAACCAGGCGCTCCTCATCCTGG - Intergenic
932407700 2:71524767-71524789 CCACCTGTTGCTCATCATCCAGG + Intronic
932433954 2:71692248-71692270 CCTCCACGTGCTCCTCATCCAGG + Intergenic
942132095 2:172890565-172890587 CCTCTTGGTGCTAATCAACCAGG + Intronic
944581818 2:201138267-201138289 CCACCTGGACCTGCTCACCCAGG - Intronic
948600940 2:239107179-239107201 CCAGCTGGTGCTCTTCACCCTGG - Intronic
948747263 2:240105825-240105847 CACCCTGGTGCTCCACATCCTGG - Intergenic
1171372780 20:24672508-24672530 TCTCCTGGTGCAAATCATCCTGG - Intergenic
1173820434 20:46016296-46016318 CCACCTGGTTCAACTCACTCCGG - Exonic
1174257196 20:49265815-49265837 CAACCTGGCCCTACTCAACCTGG - Intronic
1176933577 21:14842033-14842055 CCGCCAGGTGCTCCTCCTCCAGG + Intergenic
1179032376 21:37731869-37731891 CCACCTTGGCCTCCTCATCCTGG - Intronic
1179371670 21:40811571-40811593 CCACCTGGTTCTGCTGCTCCAGG - Intronic
1179631880 21:42683883-42683905 CCACTGGGTGCTTCTCCTCCTGG - Intronic
1184407266 22:44307210-44307232 CCACCTGGGGCTGCTGACCCAGG + Intronic
1184470397 22:44692500-44692522 CCACCTGGCACTCCTCCTCCTGG + Intronic
950303208 3:11899534-11899556 CCAACAGGTTCTACTAATCCTGG - Intergenic
952251932 3:31664138-31664160 CCACCCGTTGCTTCTCCTCCAGG + Exonic
952967175 3:38628538-38628560 TCACCTGGGGCTTCTCCTCCAGG - Intronic
962709904 3:138077597-138077619 GCACCTTGTGCTGTTCATCCTGG + Exonic
968919217 4:3514060-3514082 CCACATGGTGGTGCTCACCCTGG + Intronic
971265575 4:25093759-25093781 CCTCCTGGTGCTCCACATGCAGG + Intergenic
973534433 4:51867195-51867217 CCACCTTGTTCCCCTCATCCAGG - Intronic
979082784 4:116363344-116363366 ACACCTGGTGCAACTGAGCCTGG - Intergenic
979335321 4:119455196-119455218 CTACCTGGCGCCGCTCATCCTGG + Intergenic
980920833 4:139084136-139084158 CCAGCTGGATCTGCTCATCCGGG - Intronic
986165171 5:5266700-5266722 CCTCCTGGGGCTACTCTTCCTGG + Intronic
986464247 5:8005673-8005695 CCACCTGGTGCTAATTCTTCAGG + Intergenic
986813527 5:11384628-11384650 CCACCTGGCGCGACTCACCTGGG - Intronic
990537036 5:56733114-56733136 CCACCTGCCGCCACTCTTCCTGG + Intergenic
994451411 5:99949577-99949599 CCACATGGAGCCACACATCCGGG + Intergenic
997294433 5:132760935-132760957 CCACCTTGCGCTTCTCCTCCTGG + Exonic
1001798551 5:174523209-174523231 CAACCAGGTCCTACTCCTCCAGG - Intergenic
1002314350 5:178333642-178333664 CATCCTGGCGCTCCTCATCCTGG + Intronic
1002357248 5:178640937-178640959 CCATCTGGAGCTACTCTTCCAGG + Intergenic
1003987071 6:11447165-11447187 CCACTCTGTGCTACTCATCTTGG + Intergenic
1004714874 6:18207315-18207337 CCACCTGGAGCTCCTCATATTGG + Intronic
1005902094 6:30225576-30225598 CCACATGGTCCTACCCAGCCTGG - Intergenic
1006936292 6:37720780-37720802 CCACCTGGTTCTACGCCTCAGGG + Intergenic
1007280999 6:40712415-40712437 CCACCTGGTGATGCTGGTCCAGG - Intergenic
1008789825 6:55216966-55216988 CCACCTGGTGCTAATTCTGCAGG - Intronic
1011853781 6:91663356-91663378 CCACCTGGTGCTGTCCATCCAGG + Intergenic
1014167750 6:118245215-118245237 CCACCTACTGCTACTTAGCCAGG - Intronic
1015313644 6:131793029-131793051 CTACCTGGTGCAGCTCAACCTGG + Intergenic
1019644356 7:2121133-2121155 CCACCTGGTCCAGCTCGTCCTGG - Intronic
1020047942 7:5057333-5057355 CCAGCTGCTGCCACTCCTCCTGG - Exonic
1021784998 7:24142640-24142662 CCAGCTGGTGGTTCTCATTCTGG + Intergenic
1022288172 7:28975186-28975208 CCACCTGGTTCTGCCCCTCCAGG - Intergenic
1023720861 7:43092652-43092674 CCACCTTGTTTTACTCTTCCTGG - Intergenic
1026792084 7:73340670-73340692 CCACCAGGTGCTGCTCTTCAGGG - Exonic
1033116699 7:138632003-138632025 CCACCTGGTTCTAAGCATCTGGG + Intronic
1039673660 8:39634233-39634255 CCACCTGGTGCTAACTCTCCAGG + Intronic
1045472970 8:102528932-102528954 CCATCTCGTGCTACACCTCCTGG - Intronic
1046628309 8:116598595-116598617 GCAGCTGGTGCTGCTCTTCCAGG - Intergenic
1047857011 8:128921827-128921849 CCACCCACTGCTAGTCATCCGGG - Intergenic
1049757215 8:144316051-144316073 TCTCCTGGTGCTACTCCTGCTGG - Exonic
1050266297 9:3893708-3893730 CCACCAGGTGCTGCTGGTCCAGG - Intronic
1050823466 9:9913788-9913810 ACACCTTGTGCTCCTAATCCAGG - Intronic
1054732572 9:68715623-68715645 CCACCAGCTGCTAATCATCAGGG + Intronic
1057196978 9:93120849-93120871 CCACCAGATGCTCCACATCCAGG + Intergenic
1060904794 9:127295119-127295141 CCACCTTATGCAACTCATCAAGG + Intronic
1061051873 9:128201535-128201557 CCTCCTGGTGCCAGTCATCCAGG + Intronic
1061328536 9:129878549-129878571 CCCCCAGGTGCCACCCATCCAGG + Intronic
1200918386 Y:8591491-8591513 GAACCTGGTGGTACTCAGCCAGG - Intergenic