ID: 1147442084

View in Genome Browser
Species Human (GRCh38)
Location 17:40453559-40453581
Sequence CTGGCTAATTTCCCTTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147442079_1147442084 -2 Left 1147442079 17:40453538-40453560 CCTGGGACCCTGCTCCAGGGTCT 0: 1
1: 0
2: 1
3: 45
4: 344
Right 1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 188
1147442081_1147442084 -9 Left 1147442081 17:40453545-40453567 CCCTGCTCCAGGGTCTGGCTAAT 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 188
1147442069_1147442084 28 Left 1147442069 17:40453508-40453530 CCAAAGGGTAATGCTGGCCATAG 0: 1
1: 0
2: 1
3: 13
4: 85
Right 1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 188
1147442082_1147442084 -10 Left 1147442082 17:40453546-40453568 CCTGCTCCAGGGTCTGGCTAATT 0: 1
1: 0
2: 1
3: 31
4: 425
Right 1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 188
1147442076_1147442084 11 Left 1147442076 17:40453525-40453547 CCATAGCAGGGGGCCTGGGACCC 0: 1
1: 0
2: 1
3: 37
4: 294
Right 1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147442084 Original CRISPR CTGGCTAATTTCCCTTCTGA AGG Intronic
900795789 1:4707527-4707549 CTGGCTTCTTTCCCTGCTCAGGG + Intronic
905379970 1:37554817-37554839 TTGGCTAACTTCCCTACTGCTGG - Intergenic
906552355 1:46675631-46675653 CTGGCCATTGTCCCTTCTGTTGG - Exonic
907526394 1:55056476-55056498 CTGGCCACTCTCCCTCCTGAAGG + Intronic
908553462 1:65233166-65233188 CTGGCCACTTTCCCTTCTTTTGG + Intergenic
911006334 1:93228554-93228576 CTGTCTACCTTCCCTTATGAAGG + Intronic
911484218 1:98485206-98485228 CTGCGTAGTTGCCCTTCTGAAGG - Intergenic
912105685 1:106270902-106270924 CTGGCTTATTTGCTTCCTGATGG + Intergenic
916476448 1:165173942-165173964 CTGGCACAGTTCCCTGCTGAAGG - Intergenic
917928646 1:179808943-179808965 CTGGCTAATTTCTGTACTAATGG - Intronic
919690778 1:200526886-200526908 CTGGCTAACTACCCATCTGCCGG + Intergenic
919696788 1:200584958-200584980 CTGGCTTATTTCACTTTTGGTGG - Intronic
920833281 1:209484527-209484549 CAGTCTATCTTCCCTTCTGAAGG + Intergenic
921160374 1:212468123-212468145 GTGGCTGATTTCTCTCCTGAAGG + Intergenic
921815678 1:219560709-219560731 CTGGCTAATTTCTCTTGTTATGG - Intergenic
1062940315 10:1416119-1416141 CTGTCTTATTTCCCTCCTGCAGG + Intronic
1064300773 10:14120859-14120881 CTGGCTGATGTCCCTTCACATGG + Intronic
1067197285 10:44132982-44133004 CTGGCTGATTTCACATCTGAGGG + Intergenic
1068002909 10:51357369-51357391 TTGGCTCATTTGCCTTCTGTTGG + Intronic
1068844955 10:61661676-61661698 CTTGTTATTTTCACTTCTGAAGG - Intergenic
1070605584 10:77895996-77896018 CTGGCTAATTTTTGTTCTGAAGG - Intronic
1071930639 10:90465947-90465969 CTGGCGCATTTGCCTTGTGAAGG - Intergenic
1072433446 10:95394197-95394219 CTGGGTAATTTTCCTGTTGACGG + Intronic
1072998468 10:100267376-100267398 CTGGCCCTTTTCGCTTCTGAGGG - Intronic
1074977004 10:118589092-118589114 CTGGCTAATTCCACTGCAGAAGG - Intergenic
1077920351 11:6637371-6637393 ATTGCTAATATCCCTTCTGGGGG + Intronic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1079095157 11:17505255-17505277 CTGGCCAGTTTCCCATCTGAGGG + Intronic
1079779552 11:24583588-24583610 GTGTCTACTTTCCCTTATGAGGG - Intronic
1079901303 11:26189198-26189220 CTGGATAATTTTTCTCCTGAAGG + Intergenic
1081142304 11:39516469-39516491 CTGTCTCATTTCTCTTCTGTAGG - Intergenic
1081311861 11:41583999-41584021 CTGGCTATTTTCATTTCTGTTGG + Intergenic
1085364921 11:75931639-75931661 CTTTCTATTTTCCCTTATGATGG + Intronic
1086381871 11:86262971-86262993 CTGGCTAATTTATTTTCTGTAGG + Intronic
1087199543 11:95331833-95331855 CTCCCTAATGTCCCTTCTAAGGG - Intergenic
1088128866 11:106462704-106462726 CTGCCAAATTTCCCTTCAGAAGG - Intergenic
1088795039 11:113260593-113260615 CTGGGGCATTTCCCATCTGAGGG - Intronic
1089679159 11:120109878-120109900 CTGGCTAAATTCCCCTGTGGGGG - Intergenic
1089963780 11:122638475-122638497 CTGGCTTCTGTCCCCTCTGATGG + Intergenic
1090771229 11:129921296-129921318 CTGGCTAATGTCACTTCATATGG - Intronic
1093644059 12:21562917-21562939 CAGGCTAAATTTCCTGCTGAGGG - Exonic
1094084080 12:26569885-26569907 TTGGGTTATTTCACTTCTGACGG - Intronic
1094344674 12:29454028-29454050 CTGTGGAATTTCTCTTCTGATGG - Intronic
1098018075 12:66127385-66127407 CTGGCTTATTTCCCTTAGCATGG - Intronic
1098503785 12:71225861-71225883 CTTGCAAATTTGTCTTCTGAAGG + Intronic
1104292317 12:127481932-127481954 CTGACTAAGCTTCCTTCTGACGG - Intergenic
1104708137 12:130963862-130963884 CTGCCAAATTACCCTTCAGAAGG + Intronic
1106342131 13:28840464-28840486 CTGAATAATTTCCCATCAGATGG - Intronic
1107638889 13:42421052-42421074 TTGTCTAATTTCCCTTCAGTGGG - Intergenic
1109464352 13:62709873-62709895 TTGGCTAATTGCCCTTGTTAGGG + Intergenic
1110535536 13:76646860-76646882 CTGGATAATCTCCCTTTTTAAGG + Intergenic
1111843722 13:93482369-93482391 TTGCTTAATTGCCCTTCTGAGGG + Intronic
1120019823 14:79515880-79515902 GTGGCTTCTTTCCCTTCTGGGGG + Intronic
1120130032 14:80795741-80795763 CTGCCCAATTTTACTTCTGAAGG - Intronic
1122904012 14:104793714-104793736 CTTCCTCATTTCCCCTCTGATGG + Exonic
1128646319 15:69381182-69381204 CTGACTCTATTCCCTTCTGAAGG - Intronic
1128847480 15:70913455-70913477 CTGGATAACTTCCCCTCTGTTGG - Intronic
1128869637 15:71143984-71144006 CCTGCTAATTTCCCTTCTGTGGG - Intronic
1129879642 15:78998325-78998347 CTGCCTCATTTCCTTTCTGTTGG + Intronic
1131239806 15:90729422-90729444 CAGGCTGAGTTCCCTTCTGGAGG + Intronic
1131963910 15:97817639-97817661 CTTGCTCGTTTCCCTTCTGCAGG + Intergenic
1132438730 15:101836939-101836961 CTGGCTAGCTTCCATTCTGCAGG + Intergenic
1133867741 16:9659757-9659779 CTGTCTCATTCCCCTTCTCATGG + Intergenic
1134183378 16:12064823-12064845 CTGCCTTTTGTCCCTTCTGAGGG + Intronic
1135036203 16:19079174-19079196 CTGGCTGATTTTGCTTGTGAAGG - Exonic
1139808178 16:69587684-69587706 CAGCCTAATTTCACTTCTTATGG + Intronic
1140285705 16:73600714-73600736 CTGGCCATTTTCTCTTCTAATGG + Intergenic
1141543879 16:84749717-84749739 CTTCTTAATTTCACTTCTGATGG - Intronic
1145293105 17:21565487-21565509 CTGGGAAAGTTCCCTTATGAGGG + Intronic
1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG + Intronic
1150004262 17:61460116-61460138 CTGCCTAACTTCCCTTCTCTGGG - Intronic
1154973821 18:21437513-21437535 CTGGCTTATGTGCCTCCTGATGG + Intronic
1157155584 18:45262394-45262416 CTGGCTAACTCCCCTTTTGCTGG - Intronic
1158724853 18:59961571-59961593 CTGGATAATTTAGCTCCTGAGGG + Intergenic
1159610381 18:70518532-70518554 CTGGCTGATTTCCCTGCCCACGG + Intergenic
1161206323 19:3042926-3042948 CTGCCTGGTTTCCCCTCTGAGGG - Intronic
1163867323 19:19785077-19785099 CTGTCCAATCTTCCTTCTGATGG + Intergenic
1164645188 19:29854075-29854097 TGGGCAAGTTTCCCTTCTGATGG - Intergenic
1166340159 19:42132528-42132550 CAGGGTATTTTCCCTTCTGAAGG - Intronic
1166385595 19:42378845-42378867 TTGGATAATTGCCCTTATGATGG + Intergenic
926774036 2:16404667-16404689 TTGGCTTATTTCCCATCTCATGG + Intergenic
927779574 2:25928627-25928649 CTGGCTACCTTCCCTTCTGGAGG + Exonic
928110087 2:28500362-28500384 CTGACTTTTTTCCCTTGTGAAGG + Intronic
928149662 2:28814618-28814640 CTCAGAAATTTCCCTTCTGAAGG - Exonic
930225239 2:48785396-48785418 CTGGGTCATTTACTTTCTGAAGG + Intergenic
933674037 2:85037421-85037443 CTGACTAGTGTCCATTCTGAAGG + Intronic
934614538 2:95763042-95763064 CTGACAAATTTCCCTCCTGTGGG + Intergenic
934646366 2:96061457-96061479 CTGACAAATTTCCCTCCTGTGGG - Intergenic
934839770 2:97617539-97617561 CTGACAAATTTCCCTCCTGTGGG - Intergenic
935769548 2:106404101-106404123 GTGTCTAAAATCCCTTCTGATGG + Intronic
935910546 2:107891827-107891849 GTGTCTAAAATCCCTTCTGATGG - Intergenic
935968668 2:108508667-108508689 GTGTCTAAAATCCCTTCTGATGG - Exonic
936132340 2:109856970-109856992 GTGTCTAAAATCCCTTCTGATGG - Exonic
936212357 2:110514515-110514537 GTGTCTAAAATCCCTTCTGATGG + Exonic
936421497 2:112369082-112369104 GTGTCTAAAATCCCTTCTGATGG + Intergenic
942327254 2:174786538-174786560 CTGGCTTATTTCCCTTGGCACGG - Intergenic
942542542 2:177029697-177029719 CTGGCTAATTCACCTGCAGAGGG + Intergenic
944159904 2:196648023-196648045 CTGGCTTATTTCCCTATTGATGG + Intronic
947941052 2:234055303-234055325 CTGGCAGAATTCCTTTCTGATGG + Intronic
1168761238 20:350949-350971 CAGGCTATTTTCTTTTCTGAAGG - Intronic
1169385637 20:5147085-5147107 CTGGGAAATGTCCCTCCTGAGGG + Intronic
1172902263 20:38343939-38343961 CTGGCTAAGGTCCCTGCTGATGG - Intergenic
1172928656 20:38565007-38565029 CTGGCCCAACTCCCTTCTGAGGG + Intronic
1174255434 20:49251117-49251139 CTGGCTCTACTCCCTTCTGAAGG + Intronic
1177938727 21:27382478-27382500 GTGGCTAATGTTCCTTCTGTAGG + Intergenic
1178311138 21:31530994-31531016 ATGGCTAATTTCTCTCCAGATGG + Intronic
1178838047 21:36114849-36114871 CTGGATAATCTGCCTTCTCAAGG - Intergenic
1179035374 21:37754829-37754851 GTGGCTAGTTTCCCTTTTGGGGG + Intronic
1181135823 22:20765606-20765628 CTGGCTGTATTCCGTTCTGATGG - Exonic
1181433740 22:22898444-22898466 CTGCCTTCCTTCCCTTCTGAGGG - Intergenic
1181434681 22:22903813-22903835 CTGCCTTCCTTCCCTTCTGAGGG - Intergenic
1183208041 22:36432905-36432927 GTGGCTAATTTTCCTTTTTAGGG - Intergenic
1184073808 22:42163454-42163476 CTTCCTAATTTCCCTACTGAAGG - Intronic
1184249378 22:43251461-43251483 CAGGATAATTTCCCGTCTCATGG - Intronic
949598624 3:5574780-5574802 CAGGCTAATGCCCCTCCTGATGG - Intergenic
950496849 3:13338945-13338967 CTGGCTGATTTTTCTCCTGAGGG - Intronic
950782656 3:15405304-15405326 CAGTCTACTTTCCCTTCTGAAGG - Intronic
955310578 3:57882589-57882611 ATGGCTAATTTCCCTTATAATGG - Intronic
955452685 3:59087020-59087042 CTGCCTATTTTCCCTTCTCCTGG + Intergenic
955791778 3:62595567-62595589 TTGGCTACTTTCCCTTCCCAAGG + Intronic
957322505 3:78650469-78650491 CTTGCTAAGTCCCCTTGTGACGG + Intronic
958659493 3:97047817-97047839 ATGGGTTATTTTCCTTCTGAAGG + Intronic
959664590 3:108906357-108906379 CTGGCTATTTTCACTACTGGCGG - Intergenic
960742691 3:120852300-120852322 CACAGTAATTTCCCTTCTGAAGG - Intergenic
960897945 3:122525895-122525917 CTGGCTTTATTCCTTTCTGAGGG + Intergenic
961127455 3:124433046-124433068 CTGGCATATTTTCCTTCTGATGG - Intronic
961602367 3:128071804-128071826 CTGGAAAAGTTCCCTTCTGATGG + Intronic
962196407 3:133367496-133367518 CTGCCTAATTTCCCATTTCAAGG - Intronic
963040130 3:141064426-141064448 CTGGCTAATGTTCAATCTGAGGG - Intronic
965537931 3:169843386-169843408 CTGGCTGAGTTCTCATCTGAAGG - Intronic
965676828 3:171206437-171206459 CTGGCCAATTGCTCTTCTCATGG - Intronic
966023507 3:175245798-175245820 CTAGCTAGTGTCCCTTCTAATGG + Intronic
972035958 4:34521084-34521106 CTGGCTTTTTTCGCTTGTGAAGG - Intergenic
972761738 4:42112623-42112645 TTGGTTAATTTGACTTCTGAAGG - Exonic
974225040 4:59030680-59030702 ATTGCTAATTTACCTTCTGCAGG + Intergenic
974244060 4:59290789-59290811 CTTGCTATTTTCTCTTCTGGTGG + Intergenic
975379644 4:73684304-73684326 CATGCTAATCTCCCTTCTGATGG - Intergenic
976092738 4:81474118-81474140 CTGCCAAATTTCCCTTCTCTGGG + Intronic
984265839 4:177496721-177496743 CTGGCGTTTGTCCCTTCTGATGG - Intergenic
984588394 4:181588752-181588774 TAGGCTAATTTTGCTTCTGAAGG - Intergenic
984893767 4:184517104-184517126 CTGGTTACTTTCCCTTAGGAGGG + Intergenic
990095682 5:52109333-52109355 CTGGCTACTTTTCCTTCTTCAGG + Intergenic
990373488 5:55145486-55145508 GTGGCAAATTTTGCTTCTGAAGG + Intronic
992738114 5:79744415-79744437 CTGGCTCTTATCCCTTCTGCAGG + Intronic
992825762 5:80548353-80548375 CTGGCTCCTTTCCATCCTGATGG - Intergenic
995182772 5:109244438-109244460 ATGGCTATTGTCCCTTCTGGAGG - Intergenic
995249664 5:109977235-109977257 CTGGCTTATTTCCCACCTTAGGG + Intergenic
995689056 5:114803120-114803142 GTGGCTCCCTTCCCTTCTGAGGG + Intergenic
995834085 5:116383265-116383287 CTGGCTCAGTTCCCTTTTTAAGG - Intronic
996740823 5:126797088-126797110 CTGGCTAATTTTCTTTTTAATGG + Intronic
1000999602 5:167993395-167993417 ATGCTTAATTTCCCTTCTGATGG - Intronic
1001464475 5:171951233-171951255 GTGGCTAGTTTTCCTTTTGAGGG - Intronic
1001519329 5:172379547-172379569 CAGGCAATTTTCCCTGCTGAGGG + Intronic
1002917137 6:1538458-1538480 ATGGCTAATTTCCCTGCAGCTGG + Intergenic
1003292623 6:4793112-4793134 CTGGCAAATTTCTCTCCTCATGG + Intronic
1007670645 6:43550457-43550479 CTGGCTCTTTTTCCTTCTGTGGG + Intronic
1008180249 6:48319379-48319401 CTGGAAAATTTTCCTTCTCATGG - Intergenic
1008246930 6:49187589-49187611 CTGGATAAATTCCATTCTCACGG + Intergenic
1008483709 6:52012866-52012888 ATGGCTACTTTCATTTCTGAAGG + Intronic
1010627776 6:78159555-78159577 CTGACTCATTTGCCTTCTAAGGG - Intergenic
1010697027 6:78988950-78988972 CTGGCTTATTTTTCTTCTGCTGG + Intronic
1010833249 6:80556247-80556269 CTGGCTAATTTAACTACAGAAGG - Intergenic
1012148335 6:95714510-95714532 CTGGATAATTTCTCTTTTCAAGG - Intergenic
1012485137 6:99712640-99712662 TGGGCTCATTTCCATTCTGAAGG + Intergenic
1012520512 6:100115822-100115844 ATTGGTATTTTCCCTTCTGATGG - Intergenic
1015379471 6:132550332-132550354 TAGGCTAAATTCCCTACTGAAGG + Intergenic
1016258991 6:142145212-142145234 GTGGCAAAATTCACTTCTGAAGG + Intergenic
1022095537 7:27139045-27139067 CCGCCTAAGTTGCCTTCTGAGGG + Intronic
1023069044 7:36410026-36410048 ATTCCTAATTTTCCTTCTGAAGG + Intronic
1024092871 7:45961161-45961183 ATGGCCATTTTCCTTTCTGAGGG - Intergenic
1024493267 7:50011467-50011489 TTGGCAAATTTTCCTTGTGAAGG - Intronic
1025770942 7:64505993-64506015 CAGGATAATCTCCCTTTTGATGG + Intergenic
1028146276 7:87323374-87323396 CTGTCTTATTTCCCTCCTCAAGG + Intergenic
1028471057 7:91206659-91206681 CTGGCCAATTTTCATTCTGCTGG + Intronic
1028650741 7:93148259-93148281 CTGTCTCATTCCTCTTCTGATGG + Exonic
1030218058 7:107066980-107067002 CTGGCCACATTGCCTTCTGATGG - Intronic
1030737240 7:113064024-113064046 TAGGCAAATTTCCCTTCTGTAGG - Intergenic
1030927031 7:115470610-115470632 CTCCCTAATTTCCTTTCTGTAGG + Intergenic
1032502556 7:132410802-132410824 CCAGCTAGTTCCCCTTCTGACGG + Intronic
1033064392 7:138140138-138140160 CTGGCTAATTTTTTTTTTGAGGG + Intergenic
1033190296 7:139271956-139271978 CTGGTTAATTTCCATTGTGATGG - Intronic
1033707525 7:143903536-143903558 CTAGATAATTTCCCATCTCAAGG + Intergenic
1034460360 7:151194629-151194651 CTTGCTAATGTCCCTTGTGGTGG - Intronic
1038505427 8:28080266-28080288 CTGGCTTGTTTTACTTCTGAGGG - Intronic
1038927648 8:32158146-32158168 GTAGCTAATTCCTCTTCTGAAGG + Intronic
1041574769 8:59381339-59381361 CTGCCAGATTTCCCTTCTGTGGG + Intergenic
1042699664 8:71598417-71598439 CTGCCTAATCTCCATTCTCAAGG - Intergenic
1048736596 8:137508910-137508932 CTGTCTGAATTCCCTGCTGAAGG - Intergenic
1050282450 9:4065099-4065121 CTGGCTATTTTTTCTTCTGTCGG + Intronic
1053458476 9:38250267-38250289 CTGTCTAATGTCCCTTCTCATGG + Intergenic
1054983981 9:71240311-71240333 CTAGCTAATCTCTCTTCTAATGG - Intronic
1056131568 9:83592336-83592358 CTGGCTGATTTAGCATCTGATGG + Intergenic
1058940035 9:109804667-109804689 CTGGCAAATTTTACTTCTGTGGG + Intronic
1059011339 9:110464997-110465019 CTGACTAACATCCCTACTGAGGG - Intronic
1059665120 9:116439000-116439022 CTAACTAATCTCCCTTTTGAAGG + Intronic
1060039382 9:120286682-120286704 CTGGCTAAGTGCCCTTCAGCAGG - Intergenic
1186220222 X:7342194-7342216 CTGGATTATTTCCTCTCTGAAGG - Intronic
1187204032 X:17165135-17165157 CTGAAGAATTTCCCATCTGATGG - Intergenic
1187942716 X:24397771-24397793 CTGCCTAATTTACATTCGGAAGG + Intergenic
1188075023 X:25764993-25765015 CTGGAGAATTTCCCACCTGAGGG - Intergenic
1189559394 X:42176804-42176826 CTTGCTAACTTCCCTTCTGCAGG - Intergenic
1189921377 X:45906234-45906256 CTGGCTGATATTCCTTCAGAGGG - Intergenic
1192589964 X:72351514-72351536 CTGGCTAATGTCACCTCAGAAGG - Intronic
1192944090 X:75946347-75946369 CTTGGTTATTTCCCTTCTGATGG + Intergenic
1193935046 X:87608450-87608472 CTGCACAGTTTCCCTTCTGAAGG + Intronic
1195831664 X:109066124-109066146 CTGGCTTATTTCACTTATCATGG + Intergenic
1197737642 X:129863565-129863587 TTGGCAAATATCCCTTCGGAAGG - Intergenic
1200734116 Y:6775478-6775500 CTGCCTCATCTCCCCTCTGAAGG + Intergenic
1200964618 Y:9024832-9024854 CTGTCAAATTTCCCATTTGAGGG - Intergenic
1201254878 Y:12097438-12097460 CTGGCTGAGTTCTCTACTGAGGG - Intergenic
1202148168 Y:21821521-21821543 CTGGCAAATTTCCGATTTGAGGG + Intergenic