ID: 1147445005

View in Genome Browser
Species Human (GRCh38)
Location 17:40469707-40469729
Sequence GGATCCTTGGGTCTCATTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147444996_1147445005 4 Left 1147444996 17:40469680-40469702 CCCGGGGGTCTCTGTCTTTCCCA No data
Right 1147445005 17:40469707-40469729 GGATCCTTGGGTCTCATTATGGG No data
1147444997_1147445005 3 Left 1147444997 17:40469681-40469703 CCGGGGGTCTCTGTCTTTCCCAG No data
Right 1147445005 17:40469707-40469729 GGATCCTTGGGTCTCATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147445005 Original CRISPR GGATCCTTGGGTCTCATTAT GGG Intergenic
No off target data available for this crispr