ID: 1147448198

View in Genome Browser
Species Human (GRCh38)
Location 17:40487796-40487818
Sequence AGGGCTCCTGGGAGTCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 324}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147448198_1147448212 25 Left 1147448198 17:40487796-40487818 CCCCCATGACTCCCAGGAGCCCT 0: 1
1: 0
2: 2
3: 44
4: 324
Right 1147448212 17:40487844-40487866 CCACACCGTGGCTGATGCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 162
1147448198_1147448208 1 Left 1147448198 17:40487796-40487818 CCCCCATGACTCCCAGGAGCCCT 0: 1
1: 0
2: 2
3: 44
4: 324
Right 1147448208 17:40487820-40487842 CAGATGGGCTGAACCTACGCTGG 0: 1
1: 0
2: 0
3: 6
4: 55
1147448198_1147448213 26 Left 1147448198 17:40487796-40487818 CCCCCATGACTCCCAGGAGCCCT 0: 1
1: 0
2: 2
3: 44
4: 324
Right 1147448213 17:40487845-40487867 CACACCGTGGCTGATGCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 150
1147448198_1147448209 13 Left 1147448198 17:40487796-40487818 CCCCCATGACTCCCAGGAGCCCT 0: 1
1: 0
2: 2
3: 44
4: 324
Right 1147448209 17:40487832-40487854 ACCTACGCTGGACCACACCGTGG 0: 1
1: 0
2: 0
3: 4
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147448198 Original CRISPR AGGGCTCCTGGGAGTCATGG GGG (reversed) Intronic
900168950 1:1257036-1257058 TGGGCTCCTGAGCTTCATGGTGG - Exonic
900654985 1:3752404-3752426 TGGGCTCCTGGGAGCAGTGGTGG - Exonic
900780885 1:4616517-4616539 AGGGCACCTGGTAGGCAGGGAGG + Intergenic
900793328 1:4693346-4693368 TGGGGGACTGGGAGTCATGGAGG + Intronic
901016155 1:6232470-6232492 GTGGCTCCTGGGATTCAGGGTGG - Intronic
901218702 1:7570071-7570093 AGGGGTCCTGGGAGGCCTTGGGG + Intronic
901232552 1:7649325-7649347 GCGGGGCCTGGGAGTCATGGGGG + Intronic
901857715 1:12054845-12054867 AGGGGTCCTAGCAGACATGGCGG - Intergenic
902771670 1:18648756-18648778 AGGGCAGCGGGGAGCCATGGAGG + Intronic
903847864 1:26289241-26289263 AGGGCTGCTGTGAGGCTTGGAGG + Intronic
904616905 1:31754901-31754923 AGGGCTGCTAGGAGTGCTGGAGG - Intronic
904834258 1:33324694-33324716 AAGGCCCCTGAGAGCCATGGAGG + Exonic
905974203 1:42163541-42163563 TGGGCTCCTGGGGCTCCTGGAGG + Exonic
906656867 1:47554490-47554512 AGGGCTTCTGGGGATCATGGAGG + Intergenic
907283214 1:53363993-53364015 AGGGACCCTGGGAGTAAGGGTGG - Intergenic
907757174 1:57322031-57322053 AGGGCCAGTGGGATTCATGGAGG - Intronic
909499677 1:76320235-76320257 TGGCCTACTGGGAGTCATAGGGG - Intronic
912490886 1:110062015-110062037 AGGTCTCCAGGGAGTCACTGAGG - Intronic
912795146 1:112688874-112688896 AGGGCTCGAGGGAGGCAGGGCGG - Intronic
912933022 1:113981218-113981240 AGGCCTCCTGGAAGACCTGGTGG + Exonic
914754022 1:150553081-150553103 AGGGCTTCTGGATGTCTTGGGGG - Exonic
915266097 1:154719139-154719161 AGGGCTCCTGGGGCTGCTGGAGG - Intronic
915355785 1:155254733-155254755 AGTGCTCCTGGGCATCCTGGTGG - Exonic
915489161 1:156241975-156241997 GGGGCCCCTGGGAGTGATGGAGG - Exonic
915593111 1:156881701-156881723 GGGGCTGCTGGGAGCTATGGGGG - Intronic
915595745 1:156895431-156895453 AGGCCTCCCAGGACTCATGGGGG + Intronic
917002681 1:170376660-170376682 TGGGCTGCTGAGAGTCATAGTGG + Intergenic
917455730 1:175184016-175184038 AGGACTCCTAGGAGGCCTGGCGG - Intronic
917656747 1:177134138-177134160 AGTGCTCCTTGGAAGCATGGGGG - Intronic
917788368 1:178483645-178483667 AGGGTCCCTGGGTGCCATGGTGG - Intergenic
918105854 1:181414523-181414545 CGGGCTCCTGGGATTCAGAGAGG + Intronic
919777310 1:201202621-201202643 AGGGCTCCTGAGTGCCAGGGTGG - Intronic
922822537 1:228494151-228494173 AGAGCTGCCGGGACTCATGGAGG - Exonic
923800618 1:237205316-237205338 AGAGCCCTTGGGAGCCATGGAGG + Intronic
924354260 1:243152982-243153004 AGGACTTCTGTGATTCATGGAGG + Intronic
1062786537 10:269872-269894 AGGGCTCCTGGGTGTGCTTGGGG - Intergenic
1063137740 10:3231759-3231781 AGGGCTCCTGGGTTTGATAGAGG + Intergenic
1063377958 10:5565385-5565407 GGGGCCCCTGGGAGTGATGCTGG - Intergenic
1063941181 10:11131305-11131327 AGGACTCCTGGGACTCACTGTGG + Intronic
1064567351 10:16654809-16654831 AGCGCTCCTGGAAGCCAAGGTGG + Intronic
1065450409 10:25850632-25850654 ATGTCTCCTGGGAGTGATGATGG - Intergenic
1074848594 10:117420752-117420774 TCTGCTCCTGGGAGCCATGGAGG - Intergenic
1075068734 10:119306842-119306864 AGGGCACTGGGGAGACATGGGGG + Intronic
1075587140 10:123666273-123666295 CGCCCTCCTGGGAGCCATGGCGG + Intergenic
1075635430 10:124027239-124027261 AGGGGTCCTGGGACCCCTGGAGG + Intronic
1075731998 10:124641890-124641912 AGGCCTCCTGGGGGTTCTGGAGG - Intronic
1075845526 10:125542341-125542363 GGGGCTTCTGGGACTCTTGGGGG - Intergenic
1076510508 10:131011092-131011114 AGGCCTCCTGGGAGGCAGGCAGG + Intergenic
1077012685 11:385879-385901 AGGCCTCCTGGTGGTCTTGGGGG + Intergenic
1077097333 11:804657-804679 GGTGCTCCTGCGAGCCATGGCGG - Intronic
1077162669 11:1120856-1120878 ATGGCTCCTGGCATTCTTGGAGG + Intergenic
1077251502 11:1562892-1562914 AGGGCACCTGGGAGGCTTGAGGG - Intronic
1077293502 11:1812526-1812548 AGGGCTCCTGGAAATCAGTGAGG - Intergenic
1077327712 11:1970910-1970932 ATGGAGCCTGGGAGTCCTGGCGG + Intronic
1077421409 11:2451853-2451875 AGGGCTTCTGGGTGTCCTGAGGG - Intronic
1077445442 11:2588521-2588543 AGGGCTGCTGGGGGTCACGTGGG - Intronic
1077575378 11:3379000-3379022 AGGCCTCCTGAGAGACAGGGAGG - Intronic
1077664009 11:4092370-4092392 AGGCCTCCAGGGATCCATGGGGG + Exonic
1079031720 11:16991145-16991167 AGGGAGCCTGGGAGTCTCGGGGG - Intronic
1079649038 11:22903392-22903414 AGGCCTCTAGGGAATCATGGAGG + Intergenic
1079996199 11:27297521-27297543 TGGGGTCCTTGGAGTCATGGAGG - Intergenic
1082202564 11:49390482-49390504 AGGGCTCAGAGGAGTCATTGAGG + Intergenic
1083256085 11:61496290-61496312 AGGGCTCCTGGGGGTGGGGGCGG + Intergenic
1083260793 11:61521765-61521787 AGTGCTCAGGGCAGTCATGGAGG - Intronic
1083306526 11:61764743-61764765 AGGGCTCTTGGGCATCATGAGGG - Intronic
1083366499 11:62144779-62144801 AGTGCTCCTGGGAGGAAAGGCGG + Intronic
1083943695 11:65912204-65912226 AGGACTCTTGGGAGTTGTGGAGG + Intergenic
1084333967 11:68446312-68446334 AGGGGTCCTGGGAAGCAGGGGGG + Intronic
1084400507 11:68940275-68940297 GGGGCTCCTGTGAGTCTGGGGGG + Exonic
1084440089 11:69167831-69167853 ATGGCTCCTGGGAGTGATGTAGG + Intergenic
1085299738 11:75450975-75450997 ACGGCTCCAGGGAGGCAGGGCGG - Intronic
1085464973 11:76717031-76717053 AGGGCCCCTGGGAGTCATTCTGG + Intergenic
1086399659 11:86450101-86450123 GGGCCTCCTGGGAGTCATTGAGG - Intronic
1086652468 11:89309606-89309628 AGGGCTCAGAGGAGTCATTGAGG - Intergenic
1088535705 11:110858583-110858605 AGGTCCCTGGGGAGTCATGGAGG + Intergenic
1088604170 11:111512674-111512696 GGCACTCCTGGGGGTCATGGGGG + Intergenic
1090404642 11:126469424-126469446 AGGGCTCCTTGCAGCCCTGGGGG + Intronic
1091057246 11:132430502-132430524 GCGGCTCCTGGGAGCCATGAGGG - Intronic
1091095901 11:132821807-132821829 ATGTCTCCTGGGAGCCTTGGTGG + Intronic
1091143702 11:133258772-133258794 AGGGCTCCTGGCAGTGCTGGGGG - Intronic
1202810694 11_KI270721v1_random:26090-26112 ATGGAGCCTGGGAGTCCTGGCGG + Intergenic
1094386281 12:29897109-29897131 GGGGCTAATTGGAGTCATGGGGG - Intergenic
1094500692 12:31018363-31018385 ACGGATCCTGGGAATCAAGGAGG - Intergenic
1095992158 12:48042644-48042666 AGGACTCCTGGGAGCAATGGTGG + Intergenic
1096543583 12:52322136-52322158 AGAGCTCCAGGGACTCATGGAGG + Intergenic
1096618172 12:52846390-52846412 GGGGGTCTTGGGAGGCATGGTGG - Intronic
1096627235 12:52903521-52903543 CTGGCTCCTGGGAGGCATTGTGG - Intronic
1096650372 12:53059423-53059445 AGGGCTCCCGGTAGCCCTGGCGG - Exonic
1096761185 12:53843385-53843407 AGAGATCCTGGCAGTGATGGAGG + Intergenic
1096975543 12:55697512-55697534 AGACCTCATGGGAGACATGGAGG + Exonic
1101897326 12:108766616-108766638 AGGGCTCTGGGGAGCCAAGGAGG - Intergenic
1102009552 12:109609834-109609856 AGGGCTCTGGGGAGCCAGGGTGG + Intergenic
1103723199 12:122985644-122985666 AGGGGACCTGGGAGTGAGGGTGG + Exonic
1105014867 12:132780332-132780354 AGGGCACCTGGGGGTCAGGATGG + Intronic
1106359283 13:29014983-29015005 AGTGCACCTGGGAGTCATCCCGG - Intronic
1106566651 13:30890728-30890750 AGAGCTCCTGGAAGCCATAGGGG + Intergenic
1106875303 13:34065495-34065517 AGGGTCCCTGGGTGTCATGTTGG + Intergenic
1106891169 13:34247121-34247143 AGGCCTCCAGGGATTCATGCAGG + Intergenic
1106947851 13:34848542-34848564 TGGGGTCATGGGTGTCATGGGGG + Intergenic
1108589212 13:51897261-51897283 AGGGCTACAGTGAGTCATGATGG - Intergenic
1112242405 13:97695005-97695027 AGGGCCCCTGGGAATCCTGCTGG + Intergenic
1114257020 14:21011784-21011806 AGGGCTCCTGGGATAGAAGGAGG - Intergenic
1114744424 14:25132595-25132617 AGGGCACCTAGGAGTCACTGAGG + Intergenic
1118720324 14:68589473-68589495 GGGGCTTGTGGCAGTCATGGGGG - Intronic
1118721330 14:68596310-68596332 AGGGTTCCAGGGGTTCATGGAGG + Intronic
1119380848 14:74227341-74227363 GGGGCATCTGGGAGTCATCGAGG + Intergenic
1119705416 14:76779935-76779957 AGGGCTCCTGGCACTGCTGGCGG - Exonic
1120924191 14:89781792-89781814 AGGCCTCCTGTGAGAAATGGTGG + Intergenic
1121630394 14:95417769-95417791 AGGGGCCCTGGGACTGATGGAGG + Exonic
1122416458 14:101551982-101552004 TGGGCTCACGGCAGTCATGGGGG - Intergenic
1122556470 14:102583415-102583437 GGGGCTCCTGGGAGTGACGCAGG - Intergenic
1122800529 14:104227200-104227222 AGGGCTCCAGGGATTCAATGGGG + Intergenic
1123058469 14:105583629-105583651 AGTCCCCCTGGGTGTCATGGTGG - Intergenic
1123082802 14:105703862-105703884 AGTCCCCCTGGGTGTCATGGTGG - Intergenic
1124374116 15:29119977-29119999 AGGGCTGCTGGGAGGAATGCAGG - Intergenic
1125592599 15:40864185-40864207 AGGTCTGCTGGGAGCCAGGGAGG + Intergenic
1126381986 15:48058229-48058251 TGGGTTCCTTGGAGTCATGATGG - Intergenic
1126784220 15:52163548-52163570 CCAGCTCCTGGGAGTCAGGGTGG + Intronic
1128143971 15:65322115-65322137 AGGGCTCCTTGGACTCAAGAGGG - Intergenic
1128514746 15:68335269-68335291 TGGGCTCCTGGGAAGCAAGGTGG - Intronic
1128775645 15:70318083-70318105 AGGAATCCTGGGAGTCCTGTGGG + Intergenic
1130569394 15:85027131-85027153 AGGCCTTCAGGGAGTCCTGGAGG - Intronic
1131442599 15:92470141-92470163 ATGGGTCCAGGCAGTCATGGGGG + Intergenic
1132790896 16:1687045-1687067 AAGGCTGCAGTGAGTCATGGTGG - Intronic
1134091896 16:11395999-11396021 AGGGCTGCTGGGAGTAAGGAGGG + Intronic
1134431424 16:14211399-14211421 TGGGCTCCTGGGAGTCTTTGTGG + Intronic
1136070534 16:27784560-27784582 AGGGGTCCTGGGACTCCAGGGGG - Intergenic
1136588865 16:31205020-31205042 AGGGCACTGGGGAGTCATGAGGG - Intergenic
1136932985 16:34435648-34435670 AGTGATCTTGGGAGTCTTGGGGG - Intergenic
1136971587 16:34976166-34976188 AGTGATCTTGGGAGTCTTGGGGG + Intergenic
1138679520 16:58674936-58674958 AGGGCTGCTGGGAGTCATCGAGG - Intronic
1139563577 16:67758915-67758937 AGGTCTCCTGTGGGTCAGGGAGG + Intronic
1139824042 16:69743003-69743025 AGAGCTCCTGAGAGAAATGGCGG + Intronic
1140288004 16:73622737-73622759 AGAGCTGCTGGGAGTCATGAAGG - Intergenic
1141096582 16:81167414-81167436 AGGGCTTCTGGGAGGCAGTGTGG - Intergenic
1141204561 16:81923565-81923587 CGGGCTCCTTGGAGACATTGTGG - Exonic
1142186868 16:88698840-88698862 AGGCCTCCTGGGACCCAGGGTGG - Intronic
1142198862 16:88751549-88751571 AGGGCTCCTGGGGGAGCTGGGGG - Intronic
1142288107 16:89179647-89179669 AGGTCTCCTGGGAGCCAGCGGGG + Intronic
1142472698 17:172161-172183 AGGGCGTCTGGGAGGCCTGGAGG + Intronic
1142508676 17:381166-381188 AGGGCTTCTGGGAGGGATGTGGG - Intronic
1142508749 17:381346-381368 AGGGCTTCTGGGAGGGATGTGGG - Intronic
1142527160 17:551500-551522 AAGGCTGCAGGGAGTCATGGTGG + Intronic
1143920917 17:10330487-10330509 TGGGCTCCTGGGACTTTTGGAGG - Exonic
1144201888 17:12949265-12949287 AGCGCTCCTGTGTGCCATGGAGG + Intronic
1144960105 17:19039976-19039998 AGGGCAGTTGGGAGCCATGGAGG - Intronic
1144975055 17:19134548-19134570 AGGGCAGTTGGGAGCCATGGAGG + Intronic
1144998287 17:19285908-19285930 AGGGCTCCTGGGCCTGCTGGAGG - Intronic
1146126044 17:30232500-30232522 GGGGCTTCTGGGATTAATGGAGG + Intronic
1146712558 17:35055275-35055297 GGGGCTTCAGGGAGTCATGAAGG - Intronic
1147448198 17:40487796-40487818 AGGGCTCCTGGGAGTCATGGGGG - Intronic
1147705623 17:42423091-42423113 ACGGCTCCGGGTAGCCATGGAGG - Exonic
1148331599 17:46817119-46817141 GGGGCTCCTGGGAGAGAGGGTGG - Intronic
1150658620 17:67056714-67056736 AGGGCTCCTGGAAGCCAAGGAGG - Exonic
1150752116 17:67873897-67873919 AAGGCTCCTTGGAGAGATGGTGG + Intronic
1151324086 17:73368311-73368333 CGGGCTCTTGGCAGGCATGGGGG - Intronic
1151814879 17:76466919-76466941 CGGGCTCCTGGGGGTCCTGGAGG - Intronic
1151829105 17:76539101-76539123 ATGCCTCCTGGGGGTCTTGGAGG + Intronic
1152042818 17:77915636-77915658 AGGGCACCGGGGAGCCATGGAGG - Intergenic
1152650363 17:81489697-81489719 AGGCCTCCTGGGAGCCAGGCAGG - Intergenic
1152889906 17:82874420-82874442 AGGGAACCCGGGAGCCATGGTGG - Intronic
1153632281 18:7082987-7083009 AGGGGGCCAGGGAGTCATGGAGG + Intronic
1156633917 18:39004368-39004390 AGGACTCCTGGGAGAAGTGGTGG + Intergenic
1157814177 18:50719195-50719217 GGGGCTCCTGAGAGTCCAGGGGG - Intronic
1159679116 18:71325521-71325543 AGGCCTAGTGGGGGTCATGGTGG + Intergenic
1160121388 18:76133502-76133524 AGGGCTCCTGGAAGACTTGCTGG - Intergenic
1160515184 18:79475703-79475725 AGGTCTCCTGGGAGGCCTGGTGG - Intronic
1160541813 18:79628037-79628059 AGGACTCCTGGGTGTTGTGGGGG + Intergenic
1161238846 19:3210804-3210826 AGGGCAGCTGGGAGCCATGGAGG + Intergenic
1161537839 19:4831135-4831157 AGGGGTCCTGGGTGTCACGGAGG + Intronic
1161642770 19:5434798-5434820 AGGGCGATAGGGAGTCATGGAGG + Intergenic
1161739237 19:6010272-6010294 AGGGCTGCTGGGCCTCATGATGG - Intronic
1161982488 19:7637254-7637276 TGGGATCCTGGGTTTCATGGCGG + Intronic
1162737680 19:12755576-12755598 AGGGCTCAGGGGGGTCATTGGGG - Intronic
1163447006 19:17352829-17352851 AGGGCACTGGGGAGCCATGGAGG - Intronic
1163503147 19:17687972-17687994 AGGGCTCTCGGGGGTCCTGGTGG - Intronic
1164989493 19:32674311-32674333 AGGGCTGCTGGCAGTGCTGGAGG - Intronic
1165730745 19:38143169-38143191 AGGGCACTGGGGAGCCATGGAGG - Intronic
1165905654 19:39193033-39193055 AGGGCACTGGGGAGTCATGGAGG + Intergenic
1166297257 19:41895208-41895230 AGGGCTCCTGGGTCTGAGGGAGG + Intronic
1166665986 19:44680720-44680742 AGGGCACAGGGGAGCCATGGAGG - Intronic
1167672170 19:50859577-50859599 AGGGCACTAGGGAGCCATGGAGG - Intronic
1167740244 19:51320307-51320329 AGGGCCCCCGGGAGTCATTGGGG + Intronic
1168350991 19:55675397-55675419 CGGGCTCTGGGGGGTCATGGCGG - Intronic
925027513 2:621311-621333 AGGGCTCCCGGGAGAGAGGGAGG - Intergenic
925158413 2:1664219-1664241 AGGGCTCCTGAAAGTCTTTGGGG - Intronic
925366817 2:3316267-3316289 AGGGGTCCTGGGTGTGGTGGAGG - Intronic
925913238 2:8586877-8586899 AGGGCTGCTGTGATTCATGGTGG + Intergenic
927680910 2:25138403-25138425 AAGGCTACTGGGAGTCAGGGTGG + Intronic
930030468 2:47055569-47055591 TGGGATCATGGGGGTCATGGGGG - Intronic
931245499 2:60489404-60489426 AGGGCTTCTAGGAGACTTGGTGG - Intronic
932344094 2:70984576-70984598 AGGGCACAAGAGAGTCATGGAGG - Intronic
932702248 2:73999975-73999997 AGGGCTGCTGGAAGGCAGGGTGG + Intronic
934942687 2:98513951-98513973 AGGGGTCCTGGGACCCTTGGGGG - Intronic
935559700 2:104547476-104547498 TGGGCTCCTCGGAGGCAAGGGGG - Intergenic
935800732 2:106692655-106692677 AAGGCTAGTGGGAGTCCTGGGGG - Intergenic
935830799 2:106999170-106999192 GGGGATCTTGGGAGCCATGGAGG - Intergenic
938162403 2:128997576-128997598 AAGGCTCCTGGGGGTCCTGGGGG - Intergenic
938605734 2:132890831-132890853 AGGGCTGCTGGGCATCTTGGAGG + Intronic
942983708 2:182113564-182113586 AGAGCTCCTGGCAGTGTTGGTGG - Intronic
944818587 2:203405574-203405596 AGGGCTACTGGGAGTAATACAGG - Intronic
947077562 2:226362462-226362484 AGGTGTACTGGAAGTCATGGTGG - Intergenic
947344764 2:229179275-229179297 GGGGCTGATGGGAGCCATGGAGG - Intronic
947917306 2:233841353-233841375 GGGGGTCCTGCGAGTCCTGGTGG - Exonic
948421925 2:237865122-237865144 AGGGTTCCAGGGAGTCCTGGAGG + Intronic
948559000 2:238838072-238838094 AGGGATCATAGGAATCATGGTGG - Intergenic
948912398 2:241011103-241011125 AGGTCTCCTGGGTCTCCTGGGGG + Intronic
948912445 2:241011238-241011260 AGGTCTCCTGGGTCTCCTGGGGG + Intronic
948993243 2:241565011-241565033 AGGGCACCTGGGGGCCAGGGAGG + Intronic
949042199 2:241854579-241854601 AGGGCTCCTGGGAGGCAGCCTGG + Intronic
1168837156 20:884973-884995 TGGGCGCCTGGGAGCCATTGCGG - Intronic
1168972180 20:1938242-1938264 TGGGCCCCAGGGAGTCTTGGAGG - Exonic
1169352546 20:4880905-4880927 AGGACCCCTGGGAGACATGAGGG + Intronic
1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG + Intronic
1171223405 20:23421103-23421125 AGGGCCCCTGGGCGTCCTGGGGG + Intronic
1171227425 20:23453127-23453149 AGGGCCCCTGGGAGTCCTGGAGG + Intergenic
1171485080 20:25480477-25480499 GGGGCTCCTGTGAATCATGTGGG - Intronic
1172778095 20:37419870-37419892 TGGCCTCCTGGGAAACATGGGGG - Intergenic
1172995125 20:39064770-39064792 AGCCCTCCTGGGTGCCATGGAGG + Intergenic
1174196689 20:48777290-48777312 GGGGCTCCTGGGCCTCATGCTGG - Intronic
1174414870 20:50360028-50360050 AAGGCTCTTGGGGGACATGGGGG - Intergenic
1174892671 20:54413408-54413430 AGGGCTCTTGGGAGAAATGGGGG - Intergenic
1175237887 20:57526051-57526073 AGGGGTGCTGGGAGACTTGGGGG + Intergenic
1175237908 20:57526108-57526130 AGGGGTGCTGGGAGACCTGGGGG + Intergenic
1175978038 20:62723351-62723373 CCGGCTCCTGCGAGTCAGGGAGG + Intronic
1176030412 20:63008711-63008733 AGGGCTGGTGGGGGCCATGGGGG + Intergenic
1179568379 21:42263212-42263234 AGGGCTCATGGGATTACTGGGGG + Intronic
1179882547 21:44299683-44299705 AGGGCCCCTGGGGGGCAGGGAGG + Intergenic
1180231498 21:46429312-46429334 AGCGCTCGTGAGAGGCATGGGGG + Intronic
1180571988 22:16732999-16733021 ATAGCTTCAGGGAGTCATGGAGG - Intergenic
1181785310 22:25222369-25222391 GGGGCTCCTGAGAGTCACAGTGG + Intronic
1182279562 22:29209869-29209891 AGGGCTATAGGGAGTCATGGTGG + Intronic
1182470422 22:30544716-30544738 TGGGCCCCAGGGAGTCTTGGAGG - Intronic
1183433746 22:37781690-37781712 AGGGCACCTGGCAGTCCAGGAGG + Intergenic
1183485801 22:38087144-38087166 GGGGTTCATGGGTGTCATGGGGG + Exonic
1183744761 22:39686027-39686049 AGGGGTCCATGGAGTCGTGGTGG - Exonic
1184217446 22:43077147-43077169 AGTGCCCTGGGGAGTCATGGAGG - Intronic
1184488482 22:44795778-44795800 AGGTGTCCTGGGAGGCCTGGTGG - Intronic
1185061979 22:48611875-48611897 AGGGCTGCTGAGAGTCAGGAGGG + Intronic
1185098518 22:48825102-48825124 AGGTCTCCCTGGAGACATGGAGG + Intronic
1185330607 22:50250585-50250607 CGGGGACCTGGGATTCATGGTGG + Intronic
950792013 3:15479498-15479520 AGGGCTCCAGGGACCCATGGAGG + Intronic
950802721 3:15567505-15567527 ATGGCTTCTGCCAGTCATGGTGG - Intronic
951623276 3:24630176-24630198 AGGGCTCCTTGAAGAAATGGAGG - Intergenic
951878873 3:27460920-27460942 AGGTCTACTGGGAGTCTTGAAGG - Intronic
953863510 3:46564739-46564761 AGGGGTCCTGGGAGTTCTGAGGG - Intronic
954406468 3:50348049-50348071 AGGGCTCCTGAGAGACATAAAGG + Intronic
954411042 3:50371220-50371242 TGGGCTCCAGGCAGCCATGGGGG + Intronic
954614784 3:51964116-51964138 AGGGGGCCTGGGAGTCAGGAGGG - Intronic
955197459 3:56818298-56818320 AGGACTTCAGGGAGTCATGTGGG + Intronic
955497647 3:59551915-59551937 AGGCCTCCGGGGGCTCATGGAGG + Intergenic
957106208 3:75891407-75891429 ATAGCTCCAGGGAGTCATGGAGG + Intergenic
958718800 3:97820940-97820962 AGGGCTTCTGGGAGGCAGCGTGG + Intergenic
961826556 3:129602225-129602247 TGGGGTCCTGGGAGCCATGAAGG - Intronic
962257651 3:133883477-133883499 AGGGCCCTTGGGAGCCAGGGTGG - Intronic
962753472 3:138451304-138451326 GGGGCTTCTGGGAGCCAAGGTGG + Intronic
963603789 3:147397542-147397564 AGGGCTCCTGGAAGTACTCGGGG + Intronic
964297681 3:155251984-155252006 TGGGTTCCTTGGACTCATGGTGG - Intergenic
965673563 3:171172036-171172058 TGGGCTCCTGTGAGTGGTGGTGG + Intronic
967293294 3:187942690-187942712 AGGGCTCCTAGGTGTCATTTAGG - Intergenic
968392675 4:205778-205800 TGGGGTCCTGGGGGTCCTGGGGG - Intergenic
968801051 4:2743506-2743528 AGGGCACGGGAGAGTCATGGTGG - Intronic
968916651 4:3499688-3499710 GGGGCACCTGGGTGTCCTGGAGG + Intronic
969312848 4:6364136-6364158 GGGGCTCGAGGGAGTCATGGAGG + Intronic
969530982 4:7730011-7730033 AGTGCTCCTGGCAGTCAGGTTGG - Intronic
970419742 4:15894474-15894496 ATGGCACCTGGGGGTGATGGTGG - Intergenic
970829489 4:20320332-20320354 AAGGATCCTTGGTGTCATGGTGG + Intronic
972337468 4:38120252-38120274 AGGGCTCCTGGGATTAGAGGCGG + Intronic
972985591 4:44760641-44760663 AGGGCCCCAGGGAATCATGGAGG + Intergenic
973640951 4:52902108-52902130 AGTGCTCCTGGGAGAGTTGGGGG + Intronic
974198752 4:58611530-58611552 AATGCTCCTGGCAGTCATTGGGG + Intergenic
975549478 4:75596513-75596535 GGGGCTGCTGGGAGGCATGAGGG - Intronic
977954482 4:103011322-103011344 AAGGCTCCCAGGAGACATGGGGG - Intronic
978390376 4:108219078-108219100 TGGGCTCCTGGGTGTCAGAGGGG - Intergenic
979186918 4:117808311-117808333 AGGGCTCCTGGAAGTCCAAGAGG + Intergenic
979521158 4:121668552-121668574 ATGGCTTCTGTGAGTCATGGAGG - Intronic
980737737 4:136913068-136913090 AGGGCTCCATGGAGAAATGGCGG - Intergenic
982546214 4:156736414-156736436 AAAGCTGCTGGGAGTCTTGGTGG + Intergenic
985672764 5:1214730-1214752 AGGACTCCTAGGGGTCAGGGTGG + Intronic
986268610 5:6211846-6211868 AGGGCCACCTGGAGTCATGGGGG + Intergenic
986286872 5:6365600-6365622 AGGGCTCCAGAGAGGGATGGAGG + Intergenic
992369443 5:76127748-76127770 AGGGGTCCTGGGGGCAATGGTGG - Intronic
992611563 5:78512577-78512599 GGGCCTCCTGGGAGTCCTTGTGG - Intronic
993938923 5:94035131-94035153 AGGGCTCCTTGGAGAAAAGGCGG - Intronic
994263716 5:97689584-97689606 AGTGCTCCTGGGAGTAAATGGGG + Intergenic
995513026 5:112926800-112926822 AGGGCTCCAGTGAGCCATGATGG - Intergenic
996535905 5:124577572-124577594 AAGGCTTCTGGGAGACATTGGGG - Intergenic
997197014 5:131987140-131987162 GAGGCTCCTGGGAGACAGGGAGG + Intronic
997303830 5:132824622-132824644 GGGGCCCCTGGGAGGCATGGGGG + Exonic
997844685 5:137275964-137275986 AGGGCTCAGGGGAGGCAGGGAGG - Intronic
998190410 5:140019151-140019173 AGGACTCAAGGGAGTCATGCTGG + Intronic
999140788 5:149360107-149360129 AGGGTTCCAGGGAGTCCTGAAGG - Intronic
1000050791 5:157561467-157561489 AGGGCTTCTGGGACTCTGGGGGG - Intronic
1000291065 5:159871935-159871957 AGGGCTCCAGGGTGTCAGAGAGG - Intergenic
1001489309 5:172144596-172144618 AGCGTTCCTGGGAGGCCTGGGGG - Intronic
1001533288 5:172479851-172479873 GGGGCTCCAGGGAACCATGGTGG + Intergenic
1002254422 5:177948820-177948842 AGGTCTCCCGGGAGTCAGAGGGG - Intergenic
1002254590 5:177949836-177949858 AGGTCTCCTGGGAGTCGGAGGGG - Intergenic
1002471474 5:179438484-179438506 AGGGATCCTGGGGGTCCTGGGGG - Intergenic
1002483401 5:179517976-179517998 AGGTCTCCTGGGAGTCAGAGGGG + Intergenic
1002483571 5:179518992-179519014 AGGTCTCCCGGGAGTCAGAGGGG + Intergenic
1003015902 6:2467271-2467293 AGGGGTGCTGGGATGCATGGAGG - Intergenic
1003161140 6:3635794-3635816 AGAGCACCTGGGTGTCATGAGGG - Intergenic
1003327632 6:5104801-5104823 AGGGCTGCAGGGAGTCTAGGAGG - Intronic
1006897531 6:37480426-37480448 AGGGCACGTGGGACTGATGGAGG + Exonic
1009354717 6:62728040-62728062 AGGACTGCTGGGGTTCATGGTGG + Intergenic
1010490032 6:76464962-76464984 AGGGTTCCTGGGATTCATCCAGG - Intergenic
1014550295 6:122782374-122782396 ATGGCTCCTGGCAATCATTGAGG + Intronic
1016306693 6:142692517-142692539 AGGGATCCTGGGAGATCTGGTGG + Intergenic
1016999762 6:149988612-149988634 AGGGCTCCTCCTAGTCATGCTGG - Intergenic
1018725269 6:166607600-166607622 AGGGCTGCAGGGGGTCGTGGAGG + Intronic
1018869326 6:167769174-167769196 AGGGCTGACGGGAGTCATGGTGG + Intergenic
1019041904 6:169112869-169112891 AGGGTTGCTGCGTGTCATGGCGG - Intergenic
1019230924 6:170562158-170562180 GGGGGTCATGGGAGTCATGGGGG - Exonic
1019775531 7:2909971-2909993 AGGCCTCCTGCGATCCATGGAGG + Intronic
1020118858 7:5491762-5491784 AGGGTGCCTGGGGGTCATTGGGG - Intronic
1022629578 7:32071898-32071920 AGGGTTCCTGAGATTCAGGGTGG + Intronic
1022659548 7:32354061-32354083 AGGGATCTTGGAAGTCATAGAGG - Intergenic
1023899183 7:44461872-44461894 AGGGGTCCTGGAAGGCAAGGAGG + Intronic
1025176153 7:56803472-56803494 AGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025995555 7:66525201-66525223 CAGGCTCCTGGGAGTCTCGGAGG + Intergenic
1026775263 7:73227233-73227255 AGGGCTTCAGGAAGTGATGGGGG - Intergenic
1027016120 7:74780604-74780626 AGGGCTTCAGGAAGTGATGGGGG - Intronic
1027071908 7:75165333-75165355 AGGGCTTCAGGAAGTGATGGGGG + Intergenic
1029381912 7:100220417-100220439 AGGGCTCCTGGGAGGCCTGTGGG + Exonic
1029402076 7:100352867-100352889 AGGGCTCCTGGGAGGCCTGTGGG + Exonic
1032306094 7:130733719-130733741 AGGGCTCCTGGGAGAACTCGGGG - Exonic
1032471453 7:132182066-132182088 AGGGCTGATGGGGTTCATGGAGG - Intronic
1033276967 7:139979060-139979082 AGAGCTCCTGGGAGTTATCTTGG + Intronic
1034489901 7:151387546-151387568 AGGGCTCCTCGCAGCCACGGCGG + Intronic
1034529980 7:151689619-151689641 TGGCCTCCTGGGAGACCTGGCGG - Intronic
1034893545 7:154860457-154860479 AGGGCTGCTGGGGGCCATGGTGG + Intronic
1035272455 7:157728406-157728428 AGGGCTCCTGGCGCCCATGGCGG + Intronic
1038451488 8:27642233-27642255 ATTGGTCCTGGGAGTGATGGGGG + Intronic
1039466417 8:37788250-37788272 AGGCCTCCTGCGGGGCATGGGGG + Intronic
1040850955 8:51899624-51899646 AGGGCGCCTGGCAGGCAGGGCGG - Intergenic
1041194948 8:55392249-55392271 AGGGCTCCTTGGAGGAATGGTGG + Intronic
1042516897 8:69668762-69668784 AGGCCTCATGGATGTCATGGTGG - Exonic
1042537089 8:69870019-69870041 TGGGCAAATGGGAGTCATGGAGG - Intergenic
1044990509 8:97791353-97791375 AGACCTACTGGGAGACATGGAGG - Intronic
1049394490 8:142393381-142393403 AGGGCTCCTCTGAGTGATGACGG + Intronic
1049769872 8:144374792-144374814 AGGGGGCCTCGGAGCCATGGGGG - Intronic
1051364363 9:16310597-16310619 AGGGCCCAGGGGAGTCCTGGAGG - Intergenic
1051633224 9:19159100-19159122 AAGGCTCCAGTGAGCCATGGTGG - Intergenic
1052861244 9:33439185-33439207 AAGGCTCTTGGGAGAGATGGAGG - Intergenic
1053479149 9:38403096-38403118 AGGTCTACAGGGAGTCCTGGTGG - Intergenic
1055082748 9:72283129-72283151 ATGTCTCTTGGGAGTCAGGGAGG + Intergenic
1055489535 9:76790559-76790581 AGCTTTCCTGGGAGTCAGGGTGG - Intronic
1056268458 9:84923277-84923299 AAGGCTCCATGGAGTCATTGGGG - Intronic
1056579058 9:87877094-87877116 AGGTCTCCTGGAAGTCCTTGGGG + Intergenic
1056579815 9:87882777-87882799 AGGGCTCCTGGGGGTGGGGGAGG - Intergenic
1058416172 9:104791001-104791023 TGGGCTCCTGGGAGTTAATGGGG - Exonic
1058890162 9:109354540-109354562 AGGGCTCTGTGGAGCCATGGTGG - Intergenic
1059354060 9:113686317-113686339 AGTGCTCCATGGAGTCAGGGTGG - Intergenic
1061759950 9:132843652-132843674 AGGGCTCCTGGAAGCAGTGGAGG + Intronic
1062166703 9:135111456-135111478 AGGCCTCCTGGGGGTCGTGGAGG - Intronic
1062172734 9:135144522-135144544 AGGGCTCGTGGGGATCCTGGGGG - Intergenic
1062327066 9:136017524-136017546 AGGCTTCCTGGGACTCAGGGTGG - Intronic
1062407438 9:136403480-136403502 AGGGTTCCTGGGAGAAAGGGAGG + Intronic
1062472371 9:136712265-136712287 CGGGCTCCTGGGCGTCTCGGGGG - Intergenic
1062610641 9:137371843-137371865 AGGGCACCGAGAAGTCATGGGGG + Intronic
1062641869 9:137522919-137522941 AAGGCTCCTGGAAGCCCTGGAGG + Intronic
1185680747 X:1886765-1886787 AGGGCCCCTGGGTGTCAGTGCGG - Intergenic
1190333113 X:49247879-49247901 AGGGTTCCTGGGAGCCATTAGGG + Intronic
1190733986 X:53243236-53243258 AGGGCACCTGGGGCTCAGGGAGG + Intronic
1192216424 X:69162514-69162536 AGGGCTCCTGTGAGTATTTGTGG - Exonic
1192962858 X:76148544-76148566 AGGGCTGCTGGTTGTCACGGGGG + Intergenic
1196031136 X:111096553-111096575 AGGGCTCCGGGGAGCCACGTAGG - Intronic
1196456839 X:115896779-115896801 AGGACTCTTGTGAGTCATGGGGG + Intergenic
1198344241 X:135743771-135743793 AGAGCTCCTGGAAATCATTGTGG - Intergenic
1200764952 Y:7072688-7072710 AGGTCTACGGGGAGCCATGGTGG + Intronic