ID: 1147451673

View in Genome Browser
Species Human (GRCh38)
Location 17:40509639-40509661
Sequence TCCAAAAGTACTGCGGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147451673_1147451678 19 Left 1147451673 17:40509639-40509661 CCACATTCCGCAGTACTTTTGGA No data
Right 1147451678 17:40509681-40509703 TTGGACTGACAGGTGAGCTGAGG No data
1147451673_1147451680 30 Left 1147451673 17:40509639-40509661 CCACATTCCGCAGTACTTTTGGA No data
Right 1147451680 17:40509692-40509714 GGTGAGCTGAGGCTTAGTGTGGG No data
1147451673_1147451676 9 Left 1147451673 17:40509639-40509661 CCACATTCCGCAGTACTTTTGGA No data
Right 1147451676 17:40509671-40509693 TGCAACCTCATTGGACTGACAGG No data
1147451673_1147451679 29 Left 1147451673 17:40509639-40509661 CCACATTCCGCAGTACTTTTGGA No data
Right 1147451679 17:40509691-40509713 AGGTGAGCTGAGGCTTAGTGTGG No data
1147451673_1147451675 0 Left 1147451673 17:40509639-40509661 CCACATTCCGCAGTACTTTTGGA No data
Right 1147451675 17:40509662-40509684 GTATGTATGTGCAACCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147451673 Original CRISPR TCCAAAAGTACTGCGGAATG TGG (reversed) Intergenic
No off target data available for this crispr