ID: 1147452126

View in Genome Browser
Species Human (GRCh38)
Location 17:40512264-40512286
Sequence GGCGGCGGCGACTGAAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147452126_1147452134 12 Left 1147452126 17:40512264-40512286 CCAAGACTTCAGTCGCCGCCGCC No data
Right 1147452134 17:40512299-40512321 CCCAAACCACAGGAATGCAATGG No data
1147452126_1147452139 22 Left 1147452126 17:40512264-40512286 CCAAGACTTCAGTCGCCGCCGCC No data
Right 1147452139 17:40512309-40512331 AGGAATGCAATGGGGTCACCTGG No data
1147452126_1147452140 23 Left 1147452126 17:40512264-40512286 CCAAGACTTCAGTCGCCGCCGCC No data
Right 1147452140 17:40512310-40512332 GGAATGCAATGGGGTCACCTGGG No data
1147452126_1147452136 13 Left 1147452126 17:40512264-40512286 CCAAGACTTCAGTCGCCGCCGCC No data
Right 1147452136 17:40512300-40512322 CCAAACCACAGGAATGCAATGGG No data
1147452126_1147452137 14 Left 1147452126 17:40512264-40512286 CCAAGACTTCAGTCGCCGCCGCC No data
Right 1147452137 17:40512301-40512323 CAAACCACAGGAATGCAATGGGG No data
1147452126_1147452130 2 Left 1147452126 17:40512264-40512286 CCAAGACTTCAGTCGCCGCCGCC No data
Right 1147452130 17:40512289-40512311 ACCAGCAAACCCCAAACCACAGG No data
1147452126_1147452141 24 Left 1147452126 17:40512264-40512286 CCAAGACTTCAGTCGCCGCCGCC No data
Right 1147452141 17:40512311-40512333 GAATGCAATGGGGTCACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147452126 Original CRISPR GGCGGCGGCGACTGAAGTCT TGG (reversed) Intergenic
No off target data available for this crispr