ID: 1147452614

View in Genome Browser
Species Human (GRCh38)
Location 17:40515190-40515212
Sequence CCTTCTCTGCAGACAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147452605_1147452614 26 Left 1147452605 17:40515141-40515163 CCCCTGCATGCTGAGGCTTCTGC No data
Right 1147452614 17:40515190-40515212 CCTTCTCTGCAGACAGAAGCAGG No data
1147452608_1147452614 4 Left 1147452608 17:40515163-40515185 CCTGCATCCCTGCAGTTCTGCCA No data
Right 1147452614 17:40515190-40515212 CCTTCTCTGCAGACAGAAGCAGG No data
1147452610_1147452614 -3 Left 1147452610 17:40515170-40515192 CCCTGCAGTTCTGCCAGAGGCCT No data
Right 1147452614 17:40515190-40515212 CCTTCTCTGCAGACAGAAGCAGG No data
1147452606_1147452614 25 Left 1147452606 17:40515142-40515164 CCCTGCATGCTGAGGCTTCTGCC No data
Right 1147452614 17:40515190-40515212 CCTTCTCTGCAGACAGAAGCAGG No data
1147452611_1147452614 -4 Left 1147452611 17:40515171-40515193 CCTGCAGTTCTGCCAGAGGCCTT No data
Right 1147452614 17:40515190-40515212 CCTTCTCTGCAGACAGAAGCAGG No data
1147452607_1147452614 24 Left 1147452607 17:40515143-40515165 CCTGCATGCTGAGGCTTCTGCCT No data
Right 1147452614 17:40515190-40515212 CCTTCTCTGCAGACAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147452614 Original CRISPR CCTTCTCTGCAGACAGAAGC AGG Intergenic
No off target data available for this crispr