ID: 1147453629

View in Genome Browser
Species Human (GRCh38)
Location 17:40521114-40521136
Sequence CTGTGTGAATGGAGGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147453629_1147453637 14 Left 1147453629 17:40521114-40521136 CCTGCATCCCTCCATTCACACAG No data
Right 1147453637 17:40521151-40521173 AGACACCAGCAGGACACAGCGGG No data
1147453629_1147453633 4 Left 1147453629 17:40521114-40521136 CCTGCATCCCTCCATTCACACAG No data
Right 1147453633 17:40521141-40521163 TTCTCCTGCCAGACACCAGCAGG No data
1147453629_1147453638 18 Left 1147453629 17:40521114-40521136 CCTGCATCCCTCCATTCACACAG No data
Right 1147453638 17:40521155-40521177 ACCAGCAGGACACAGCGGGCAGG No data
1147453629_1147453640 23 Left 1147453629 17:40521114-40521136 CCTGCATCCCTCCATTCACACAG No data
Right 1147453640 17:40521160-40521182 CAGGACACAGCGGGCAGGACAGG No data
1147453629_1147453636 13 Left 1147453629 17:40521114-40521136 CCTGCATCCCTCCATTCACACAG No data
Right 1147453636 17:40521150-40521172 CAGACACCAGCAGGACACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147453629 Original CRISPR CTGTGTGAATGGAGGGATGC AGG (reversed) Intergenic
No off target data available for this crispr