ID: 1147455755

View in Genome Browser
Species Human (GRCh38)
Location 17:40537108-40537130
Sequence AGGTGGGTCTTGCACTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147455755_1147455764 22 Left 1147455755 17:40537108-40537130 CCCTCTGAGTGCAAGACCCACCT No data
Right 1147455764 17:40537153-40537175 TGATTCCCCCCCAGGTCTGCTGG No data
1147455755_1147455761 -1 Left 1147455755 17:40537108-40537130 CCCTCTGAGTGCAAGACCCACCT No data
Right 1147455761 17:40537130-40537152 TCCAGAGAGATGCTTTGGCAAGG No data
1147455755_1147455763 14 Left 1147455755 17:40537108-40537130 CCCTCTGAGTGCAAGACCCACCT No data
Right 1147455763 17:40537145-40537167 TGGCAAGGTGATTCCCCCCCAGG No data
1147455755_1147455759 -6 Left 1147455755 17:40537108-40537130 CCCTCTGAGTGCAAGACCCACCT No data
Right 1147455759 17:40537125-40537147 CCACCTCCAGAGAGATGCTTTGG No data
1147455755_1147455765 23 Left 1147455755 17:40537108-40537130 CCCTCTGAGTGCAAGACCCACCT No data
Right 1147455765 17:40537154-40537176 GATTCCCCCCCAGGTCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147455755 Original CRISPR AGGTGGGTCTTGCACTCAGA GGG (reversed) Intergenic
No off target data available for this crispr