ID: 1147456237

View in Genome Browser
Species Human (GRCh38)
Location 17:40539981-40540003
Sequence GTACTTTGGCTTGTGTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147456237_1147456244 5 Left 1147456237 17:40539981-40540003 CCAGGGGACACAAGCCAAAGTAC No data
Right 1147456244 17:40540009-40540031 GCAGGCAGAACTGGAGTACAGGG No data
1147456237_1147456242 -4 Left 1147456237 17:40539981-40540003 CCAGGGGACACAAGCCAAAGTAC No data
Right 1147456242 17:40540000-40540022 GTACAGGAGGCAGGCAGAACTGG No data
1147456237_1147456243 4 Left 1147456237 17:40539981-40540003 CCAGGGGACACAAGCCAAAGTAC No data
Right 1147456243 17:40540008-40540030 GGCAGGCAGAACTGGAGTACAGG No data
1147456237_1147456245 14 Left 1147456237 17:40539981-40540003 CCAGGGGACACAAGCCAAAGTAC No data
Right 1147456245 17:40540018-40540040 ACTGGAGTACAGGGTCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147456237 Original CRISPR GTACTTTGGCTTGTGTCCCC TGG (reversed) Intergenic
No off target data available for this crispr