ID: 1147456627

View in Genome Browser
Species Human (GRCh38)
Location 17:40542103-40542125
Sequence GGCCCCAGCCAACACCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147456627_1147456632 2 Left 1147456627 17:40542103-40542125 CCATCAAGGTGTTGGCTGGGGCC No data
Right 1147456632 17:40542128-40542150 GGTCATCTCAAGGCTGGAGCAGG No data
1147456627_1147456633 7 Left 1147456627 17:40542103-40542125 CCATCAAGGTGTTGGCTGGGGCC No data
Right 1147456633 17:40542133-40542155 TCTCAAGGCTGGAGCAGGAAAGG No data
1147456627_1147456634 22 Left 1147456627 17:40542103-40542125 CCATCAAGGTGTTGGCTGGGGCC No data
Right 1147456634 17:40542148-40542170 AGGAAAGGACCTGCCTCCCCAGG No data
1147456627_1147456629 -8 Left 1147456627 17:40542103-40542125 CCATCAAGGTGTTGGCTGGGGCC No data
Right 1147456629 17:40542118-40542140 CTGGGGCCTTGGTCATCTCAAGG No data
1147456627_1147456630 -4 Left 1147456627 17:40542103-40542125 CCATCAAGGTGTTGGCTGGGGCC No data
Right 1147456630 17:40542122-40542144 GGCCTTGGTCATCTCAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147456627 Original CRISPR GGCCCCAGCCAACACCTTGA TGG (reversed) Intergenic
No off target data available for this crispr