ID: 1147458604

View in Genome Browser
Species Human (GRCh38)
Location 17:40554206-40554228
Sequence GTGAAGAAAACGATGGAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 460}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147458600_1147458604 -5 Left 1147458600 17:40554188-40554210 CCGCTGGCTTGGAGGACAGTGAA 0: 1
1: 0
2: 1
3: 28
4: 198
Right 1147458604 17:40554206-40554228 GTGAAGAAAACGATGGAGGGAGG 0: 1
1: 0
2: 1
3: 32
4: 460
1147458598_1147458604 1 Left 1147458598 17:40554182-40554204 CCATTCCCGCTGGCTTGGAGGAC 0: 1
1: 0
2: 0
3: 2
4: 105
Right 1147458604 17:40554206-40554228 GTGAAGAAAACGATGGAGGGAGG 0: 1
1: 0
2: 1
3: 32
4: 460
1147458599_1147458604 -4 Left 1147458599 17:40554187-40554209 CCCGCTGGCTTGGAGGACAGTGA 0: 1
1: 0
2: 2
3: 20
4: 202
Right 1147458604 17:40554206-40554228 GTGAAGAAAACGATGGAGGGAGG 0: 1
1: 0
2: 1
3: 32
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147458604 Original CRISPR GTGAAGAAAACGATGGAGGG AGG Exonic
902620417 1:17647525-17647547 ATGAATAAAAGGAAGGAGGGAGG - Intronic
902752265 1:18525190-18525212 GGAAAGATAAGGATGGAGGGTGG + Intergenic
903247869 1:22029464-22029486 ATGATGAAAGAGATGGAGGGAGG + Intergenic
903331753 1:22600187-22600209 GGGAAGGAAAGGAGGGAGGGAGG + Intronic
903335078 1:22619243-22619265 GGGGAGAAGAGGATGGAGGGTGG - Intergenic
903991687 1:27275633-27275655 ATAAAGAAAAAGATGGAGCGGGG + Intronic
904146232 1:28394282-28394304 GGGAAGGAAAGGAGGGAGGGAGG + Intronic
904998523 1:34650218-34650240 GAAAAGAAAAGGAGGGAGGGAGG + Intergenic
906025289 1:42668369-42668391 AGGAAGGAAAGGATGGAGGGAGG - Intronic
906367842 1:45225785-45225807 AGGAAGGAAACGAGGGAGGGAGG + Intronic
906380521 1:45329440-45329462 GTGAAAAAATGGAAGGAGGGAGG + Intronic
906700110 1:47851464-47851486 GTGAGGAAAAAGAGGGAGGAAGG + Intronic
906951209 1:50335649-50335671 GGGGAGAAAAAGATGGAGGAGGG + Intergenic
907087734 1:51692579-51692601 AGGAAGAAAAGGAGGGAGGGAGG - Intronic
907794838 1:57706281-57706303 AGGAAGGAAAGGATGGAGGGAGG - Intronic
908372644 1:63498825-63498847 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
908390307 1:63677951-63677973 AGGAAGAGAACAATGGAGGGGGG - Intergenic
908405624 1:63811556-63811578 GGGAAAAAAAAGATGGAGTGAGG - Intronic
909299654 1:73996142-73996164 GTGAAAAAAAGGAAGGAGAGTGG + Intergenic
910026599 1:82662151-82662173 GTGAAGAAAAGAAGGGAGAGAGG + Intergenic
911094400 1:94044053-94044075 GAGAAGGAAGCGAGGGAGGGAGG - Intronic
911375184 1:97043629-97043651 GTGAAGACCAGGATGGATGGGGG + Intergenic
911532324 1:99058893-99058915 GTGATGAAAAAGAGGAAGGGAGG + Intergenic
911629820 1:100170692-100170714 AAGAAGAAAGGGATGGAGGGAGG - Intronic
913147487 1:116006654-116006676 GAGAAGGAAAGGAGGGAGGGAGG - Intronic
913686269 1:121234971-121234993 GTGAAGGAAGTGAGGGAGGGAGG - Intronic
914038120 1:144022593-144022615 GTGAAGGAAGTGATGGAGGGAGG - Intergenic
914085987 1:144455134-144455156 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
914151334 1:145045347-145045369 GTGAAGGAAGTGAGGGAGGGAGG + Intronic
915954575 1:160211286-160211308 CAGAAGAAAAAGATGGTGGGGGG + Intronic
916452100 1:164930539-164930561 GGGAAGAAAGAGAAGGAGGGAGG - Intergenic
916522794 1:165580277-165580299 GAGAAGAAAGGGAGGGAGGGAGG + Intergenic
916779520 1:168009469-168009491 GTGAAGGAAGGGAGGGAGGGAGG - Intronic
917491035 1:175498685-175498707 TTGGAGAAAACCATCGAGGGAGG + Intronic
919069571 1:192736685-192736707 TTGAAGAAAGTGATGGAGAGAGG - Intergenic
919139043 1:193547121-193547143 GTAAAGAAAGCTATGGGGGGAGG - Intergenic
919228126 1:194735563-194735585 TTGAAGAAAACAATGGTGGGGGG - Intergenic
919718516 1:200806673-200806695 CTGAAGAAACTGGTGGAGGGAGG + Intronic
919855889 1:201705760-201705782 GCGAAGAAAAGGATAGAGAGAGG + Intronic
920473591 1:206253518-206253540 GTGAAGGAAGTGAGGGAGGGAGG - Intronic
920776865 1:208947254-208947276 GTAAAGAAAAAGAAGGAAGGAGG + Intergenic
920857771 1:209676806-209676828 GGAAAGAAAATGAAGGAGGGAGG + Intergenic
922506213 1:226127317-226127339 GCCAAGAAGACGCTGGAGGGAGG + Intergenic
922858598 1:228796075-228796097 GTGAAGAAGAGTATGGAGGATGG - Intergenic
923061700 1:230481435-230481457 GCGAGGATGACGATGGAGGGAGG + Intergenic
924570776 1:245235663-245235685 GGGAAGGAAAGGAGGGAGGGAGG + Intronic
1062963853 10:1592772-1592794 GAGAAGAGACCTATGGAGGGTGG - Intronic
1062963869 10:1592835-1592857 GAGAGGAAACCTATGGAGGGTGG - Intronic
1063083750 10:2793755-2793777 AGGAAGAAAAAAATGGAGGGAGG - Intergenic
1063424015 10:5937332-5937354 GTGAAGAAAGCCAGCGAGGGGGG + Exonic
1064120597 10:12615002-12615024 GTGAAGATAACGTTGGAGATGGG + Intronic
1065683333 10:28259623-28259645 GAGAAGAGAAGGATGCAGGGAGG + Intronic
1065765645 10:29026970-29026992 GGGAAGAGAAAGAGGGAGGGAGG + Intergenic
1065933484 10:30499951-30499973 GGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1066779807 10:38931856-38931878 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1067012589 10:42728348-42728370 GTGGAGAAGAGGGTGGAGGGAGG + Intergenic
1068110986 10:52680805-52680827 AAGAAAAAAAAGATGGAGGGTGG + Intergenic
1070504708 10:77103010-77103032 GTGAATGAACCGATGGAGAGGGG + Intronic
1070908803 10:80099533-80099555 GAGAAGAAAAGAAAGGAGGGAGG + Intergenic
1070953302 10:80447952-80447974 AGGAAGGAAAGGATGGAGGGAGG - Intergenic
1071058366 10:81538541-81538563 GTGAGCAAAATGATGGAGGAAGG - Intergenic
1071867716 10:89755398-89755420 GGGAAGGAAAGGAGGGAGGGAGG - Intronic
1072306870 10:94116107-94116129 TTGAAGAAAAGGATGGAGAGAGG - Intronic
1072532786 10:96335375-96335397 GTGAATGAAAGGATGGAGGAAGG - Intronic
1073061973 10:100738604-100738626 TTGAAGAAACTGATGGAGGGAGG - Intronic
1073428409 10:103470541-103470563 GTGGAAAGAAAGATGGAGGGAGG - Intergenic
1073626021 10:105097933-105097955 GAGAAGAAAACAAAGGACGGTGG - Intronic
1074212038 10:111344141-111344163 TAGAAGAAAAAGATGGAGGAAGG - Intergenic
1074348644 10:112713160-112713182 GAGAAGGAAACTAAGGAGGGAGG - Intronic
1076471533 10:130722115-130722137 CTGAAGGCAAGGATGGAGGGAGG + Intergenic
1077480965 11:2814395-2814417 CTGAATAAAAGGATGGTGGGTGG + Intronic
1080237832 11:30092632-30092654 GGGAAGAGAAGGAGGGAGGGAGG - Intergenic
1081575240 11:44315033-44315055 GGGAAAAAAAGGAGGGAGGGAGG - Intergenic
1083611869 11:64008226-64008248 ATGGAGAAAACGAGGGAGAGAGG + Intronic
1083913774 11:65726927-65726949 GTGATGGACACGATGGAGGCAGG - Intergenic
1084470415 11:69356178-69356200 ATGAAGAGAAGGAAGGAGGGAGG + Intronic
1085868029 11:80317722-80317744 GTGTTGAAAATGCTGGAGGGAGG - Intergenic
1086867831 11:92001685-92001707 GTGGAGAAAATGAAGGAAGGAGG + Intergenic
1088031953 11:105262075-105262097 GGGAAGAAAGAGCTGGAGGGAGG + Intergenic
1088907843 11:114168293-114168315 GAGAAGACAAGGATGGAAGGCGG + Intronic
1089156356 11:116405901-116405923 TTCAAGAAAGCGGTGGAGGGAGG + Intergenic
1090023451 11:123147759-123147781 TTGAAGAAATGAATGGAGGGAGG + Intronic
1090634643 11:128683376-128683398 AAGAAGAAAAGGAGGGAGGGAGG + Intergenic
1090949023 11:131456448-131456470 TTGATGAGAACGAAGGAGGGAGG - Intronic
1091007403 11:131965940-131965962 GGGAAGGAAAGGAGGGAGGGAGG + Intronic
1091461822 12:648860-648882 GTGAACAAAAAGCTGGAGGCAGG - Intronic
1091713596 12:2760360-2760382 CTGAGGATAAAGATGGAGGGAGG + Intergenic
1091842010 12:3628114-3628136 GTGAAGGAAGGGAGGGAGGGAGG - Intronic
1093386320 12:18559714-18559736 GTCCAGAAAAAGTTGGAGGGAGG + Intronic
1093553510 12:20443973-20443995 GAGAAGGAAAAGAAGGAGGGAGG + Intronic
1093703326 12:22247117-22247139 GGGAAGGAAATGAGGGAGGGAGG - Intronic
1093901624 12:24641544-24641566 GAGAAGAAAACTATAGAGGCGGG + Intergenic
1095212862 12:39513548-39513570 GAAAAGAAAAAGAGGGAGGGAGG + Intergenic
1097318792 12:58202629-58202651 TTGAACAAAAAGATGGAGGAAGG - Intergenic
1098646246 12:72905115-72905137 GTGACAAAAAAGTTGGAGGGTGG - Intergenic
1099281883 12:80660178-80660200 GGGAAGAGAACTATAGAGGGAGG + Intronic
1099932286 12:89088294-89088316 GTGAAGAAAAGACAGGAGGGAGG + Intergenic
1099936953 12:89137703-89137725 GAGAAGAAAAGGTGGGAGGGGGG + Intergenic
1100112874 12:91267049-91267071 GTGAAGGAAAGAATGGAGGAAGG - Intergenic
1100370867 12:93967230-93967252 AGGGAGAAAAGGATGGAGGGAGG - Intergenic
1101632642 12:106510624-106510646 GTGAAGAAAAAGAAGAAGTGAGG - Intronic
1101939361 12:109088572-109088594 GTGAGGAAAACGAGGGCTGGCGG - Intronic
1102188632 12:110969040-110969062 GTGAAGAAGAAGATGGAGATCGG + Intergenic
1102646479 12:114407064-114407086 CTGGAGAAAGGGATGGAGGGAGG + Intronic
1103044825 12:117727370-117727392 GTGAAGAAAAAGAAGGAAGAAGG + Intronic
1104400635 12:128473119-128473141 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400640 12:128473167-128473189 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400677 12:128473503-128473525 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400697 12:128473689-128473711 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104559203 12:129828773-129828795 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
1104648832 12:130516529-130516551 GAGAAAAAAGGGATGGAGGGAGG + Intronic
1105664482 13:22537300-22537322 GTGAAGAGGAGGATAGAGGGAGG + Intergenic
1105709263 13:22990382-22990404 GTGAAGGTAACAGTGGAGGGAGG + Intergenic
1105709703 13:22995322-22995344 GTGAAGGAAATGAGGGAGGGAGG + Intergenic
1105715661 13:23061427-23061449 AGGAAGAAAGAGATGGAGGGGGG + Intergenic
1105913306 13:24891191-24891213 GTGAAGAAAAGGCTGCAAGGAGG - Intronic
1105965555 13:25380918-25380940 CTGAAAAAAATGCTGGAGGGAGG - Intronic
1106452963 13:29900481-29900503 GCAAAGAAAACAATGGAGTGAGG - Intergenic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1106849594 13:33775299-33775321 GGGAAGAAAAAAAAGGAGGGGGG - Intergenic
1107382975 13:39876977-39876999 GGGAAGGAAGGGATGGAGGGAGG + Intergenic
1107794445 13:44035562-44035584 GAGAAGAAAAGGAGGGAAGGAGG + Intergenic
1108563144 13:51666510-51666532 GTGGAGAAGAGGATGGAGGGAGG + Intronic
1109371895 13:61433022-61433044 GGGGAGAAAAAGAGGGAGGGAGG - Intergenic
1110351539 13:74513991-74514013 GTGAAAAAAAGGCTGGAGTGAGG + Intergenic
1110393359 13:75001623-75001645 AGGAAGAAAGGGATGGAGGGAGG + Intergenic
1110717307 13:78720979-78721001 GGGAAGGAAAAGAAGGAGGGAGG + Intergenic
1111380737 13:87447385-87447407 GTGAAGAAGTCCATGGAAGGTGG - Intergenic
1112391080 13:98985052-98985074 GTGAAGAAGACTATGGGGGCAGG + Intronic
1113594380 13:111520946-111520968 GTGAAGAAAAGAAAGCAGGGAGG - Intergenic
1114203221 14:20542513-20542535 GTGTTGAATACTATGGAGGGAGG - Intergenic
1116109421 14:40558249-40558271 GTGAAGAAAAGGAGGGTGGAAGG - Intergenic
1116188025 14:41623943-41623965 GTGAAGAAAATAATGCAGTGTGG + Intronic
1116290005 14:43022447-43022469 GAGAAGAAAGGGATGGAGGGAGG - Intergenic
1118348074 14:64954234-64954256 GTGAAGAGAAGGAGGGAGGAAGG + Intronic
1118467777 14:66046373-66046395 GTGAAGAAAGGGAAGGAAGGAGG - Intergenic
1118642806 14:67807932-67807954 ATGAAGAAAAGGATGGGTGGTGG + Intronic
1119928083 14:78516060-78516082 GTGATGAATACCATGGAGTGGGG - Intronic
1121565597 14:94907158-94907180 GAGAAGAAAACGGGGGCGGGGGG - Intergenic
1121701889 14:95961041-95961063 GTAAAGAAAGAGATGGAGGCTGG + Intergenic
1121856003 14:97270815-97270837 GTGAAGAAATAAATGGAGTGAGG - Intergenic
1123157232 14:106239900-106239922 GTAAAGAAAACAATTGAAGGAGG - Intergenic
1202937453 14_KI270725v1_random:104384-104406 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
1123709621 15:22977865-22977887 GAAAAGAAAACAAAGGAGGGAGG + Intronic
1124424738 15:29554357-29554379 AGGAAGGAAAGGATGGAGGGAGG + Intronic
1124956531 15:34363990-34364012 GTGAATAAAATGATAGTGGGTGG - Intronic
1125084515 15:35714498-35714520 GGGAAGGAAAGGAGGGAGGGAGG - Intergenic
1126660215 15:51025832-51025854 AGGAAGAAAATGAAGGAGGGAGG - Intergenic
1126710435 15:51449375-51449397 GTGAAGGAAAATATGGAAGGAGG - Intronic
1126851445 15:52799332-52799354 AGGAAGAAAAGAATGGAGGGAGG - Intergenic
1127450114 15:59108373-59108395 ATGATGAAAACAATGTAGGGAGG + Intronic
1127817720 15:62626489-62626511 GAGAAGAAAATAATGAAGGGCGG - Intronic
1128182203 15:65613833-65613855 GTGAAGAAAAGGCTGAGGGGTGG + Intronic
1128408595 15:67369551-67369573 AGGAAGAAAAGGAAGGAGGGAGG + Intronic
1128793394 15:70449084-70449106 AGGAAGAGAAGGATGGAGGGAGG + Intergenic
1129992039 15:79973865-79973887 GTGAGGGAAAAGAGGGAGGGAGG - Intergenic
1130026121 15:80271882-80271904 GTGAAGAAAGGAATGGAGAGGGG - Intergenic
1130872487 15:87982373-87982395 GTGAAGAAAAGGCTGAAGAGGGG + Intronic
1131915697 15:97263532-97263554 GAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1133647740 16:7780288-7780310 GTTGACAAAACGAAGGAGGGTGG + Intergenic
1133942484 16:10321990-10322012 GAGAAGAGGACGTTGGAGGGGGG - Intergenic
1134245280 16:12535068-12535090 GTCAAGAAAAAGAGAGAGGGAGG + Intronic
1134868839 16:17633141-17633163 AAGAAGGAAAGGATGGAGGGAGG + Intergenic
1135172614 16:20200003-20200025 GAGAAAGAAACGAAGGAGGGAGG + Intergenic
1135321999 16:21503227-21503249 AGGAAGGAAACGAGGGAGGGAGG + Intergenic
1136901093 16:34038714-34038736 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1136948933 16:34691361-34691383 AGGAAGAAAACGAGGGTGGGAGG + Intergenic
1138183965 16:54962447-54962469 TTGAAGAAAGGGAGGGAGGGAGG - Intergenic
1138217153 16:55214470-55214492 GAGAAGAACAGGAAGGAGGGAGG + Intergenic
1139341402 16:66270231-66270253 GGGGAGAAAATGAAGGAGGGAGG + Intergenic
1140879027 16:79180685-79180707 ATGAAGAAATGGAGGGAGGGAGG - Intronic
1141135166 16:81460190-81460212 GAGCAGAAAAGAATGGAGGGTGG - Intronic
1141174658 16:81710909-81710931 GTGAAGCACACGATGGCAGGGGG - Exonic
1141782443 16:86172496-86172518 GAGAAGAAAGAAATGGAGGGAGG - Intergenic
1143104573 17:4522574-4522596 GAGAAGAGAAAGAGGGAGGGAGG - Intronic
1144157809 17:12524099-12524121 GGGTACAAAAAGATGGAGGGAGG + Intergenic
1144387099 17:14758905-14758927 GTGGAGAAAACAAAGGAAGGGGG + Intergenic
1144596798 17:16576674-16576696 GTGAAGAAAAAGTGGGAGAGAGG + Intergenic
1145051891 17:19668946-19668968 AAGAAGAAAAGGAGGGAGGGAGG - Intronic
1145709116 17:26952547-26952569 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1147458604 17:40554206-40554228 GTGAAGAAAACGATGGAGGGAGG + Exonic
1148336684 17:46846776-46846798 GTGAGGAAGAAGAGGGAGGGAGG + Intronic
1148866134 17:50629693-50629715 GTGGAGAAAATGAAGGAGGCTGG + Intergenic
1148966506 17:51440433-51440455 CTGAAGAAACCCATGGAGAGAGG + Intergenic
1149027888 17:52051032-52051054 GGGAAGGAAAGGAAGGAGGGAGG + Intronic
1149218553 17:54388441-54388463 AGGGAGAAAACGAGGGAGGGAGG - Intergenic
1149309373 17:55379099-55379121 GTGAAAAATACGATGGCGTGAGG + Intergenic
1149768533 17:59300893-59300915 GAGAAGGAAACGAAGGAGGGAGG - Intergenic
1150473305 17:65455915-65455937 ATGAAGGAAAGGATGGAGGCTGG + Intergenic
1150918521 17:69460034-69460056 GGAAAGAAAAAGATGAAGGGAGG - Intronic
1150931813 17:69592962-69592984 GAGAAGAAAAAAATGGAGGGAGG - Intergenic
1151661104 17:75518634-75518656 GTGAACAAAATGATGGCAGGTGG - Intronic
1151870353 17:76832661-76832683 GTGCAGAAGATGATGGAGGAAGG - Intergenic
1152241892 17:79165256-79165278 GAGAAGAGAAAGAGGGAGGGAGG + Intronic
1152432145 17:80254403-80254425 GAGAAGAAAGGGGTGGAGGGAGG - Intergenic
1152596644 17:81240987-81241009 GCCAAGAAGACGCTGGAGGGAGG + Exonic
1153678316 18:7476048-7476070 TTCTAGAAAATGATGGAGGGAGG - Intergenic
1157365799 18:47063181-47063203 GTGAAACAAACGATGGCAGGTGG - Intronic
1157806009 18:50658064-50658086 GTCAAGAACATGATGGAAGGTGG + Intronic
1158019206 18:52821332-52821354 GTGAAGCAAATGATGAAGGAGGG - Intronic
1159133292 18:64306222-64306244 GTGAATAAATAGATGGAAGGGGG + Intergenic
1159331895 18:67005639-67005661 GTGAAGGAAAGGAGGGAGAGAGG - Intergenic
1159436907 18:68429825-68429847 ATGGAGAAAACAAGGGAGGGAGG + Intergenic
1159985457 18:74835959-74835981 GTGAAGGAAACGGTGGAGAAGGG + Intronic
1160448670 18:78947107-78947129 GAGAGGAAGAGGATGGAGGGAGG + Intergenic
1160448695 18:78947190-78947212 GGGAAGAAGAGGATGGAGGAGGG + Intergenic
1160971253 19:1768748-1768770 GTGAAGAAAACAGAGGAAGGGGG + Intronic
1161286453 19:3471008-3471030 GTGAGGAGAGGGATGGAGGGAGG + Intergenic
1162887290 19:13705032-13705054 GGGAAGAAAGGGAGGGAGGGAGG + Intergenic
1163401740 19:17098052-17098074 GTGAAGAAAAAAAAGGTGGGGGG - Intronic
1164049739 19:21574780-21574802 CTGAAGAAAATAATGAAGGGTGG - Intergenic
1164051992 19:21591590-21591612 GTAAAGAAAACCATGGATGGGGG - Intergenic
1164161775 19:22631177-22631199 GTGAAAAAAATAATGGAGGGTGG + Intergenic
1164188135 19:22890134-22890156 CTAAAGAAAATAATGGAGGGTGG - Intergenic
1164441988 19:28285422-28285444 GGGAAGAAAAGGTTGGAGGGTGG + Intergenic
1164833171 19:31338803-31338825 AAGAAAAAAAAGATGGAGGGAGG - Intronic
1165314701 19:35047464-35047486 GTGAAGAAAACCGTGCAGGCTGG - Intronic
1165587219 19:36929249-36929271 GTGAAGAAAGCGAGGCATGGTGG + Intronic
1165723839 19:38099004-38099026 GAGAAGAAAAGAAAGGAGGGAGG - Intronic
1165890387 19:39108605-39108627 GGGAAGATAAAGATGGGGGGTGG + Intronic
1166350308 19:42194949-42194971 GGGAAGGAAATGAAGGAGGGGGG + Intronic
1166863161 19:45821218-45821240 GGCAAGAAAAGGAGGGAGGGAGG + Intronic
1167268493 19:48494905-48494927 GTGAAGGAAAGGAGGGAGTGAGG - Intronic
925477308 2:4231867-4231889 GTAAAGCAAAGGATAGAGGGAGG + Intergenic
925696077 2:6580538-6580560 GTGAAGACAGAGGTGGAGGGTGG - Intergenic
925696091 2:6580729-6580751 GTGAAGACAGAGGTGGAGGGTGG - Intergenic
925798684 2:7574675-7574697 GTGAAGAATACCTTGGAGGGAGG + Intergenic
927295834 2:21452202-21452224 GAGAAACAAACGATGGTGGGAGG - Intergenic
927524383 2:23723487-23723509 GGGAGGAAAAGGAGGGAGGGAGG + Intergenic
927880067 2:26684050-26684072 GAGAAGAAAAGGAAGGAGGCAGG - Intergenic
928194602 2:29206187-29206209 GAGAAGAAAGGGAGGGAGGGAGG - Intronic
928269296 2:29841986-29842008 GTGAAGAGGAGGATGGAGGAAGG - Intronic
928373707 2:30758933-30758955 GGGAAGAAAGGGAGGGAGGGAGG - Intronic
929027591 2:37619653-37619675 GGGAAGAAAAAAAGGGAGGGTGG + Intergenic
929411555 2:41702611-41702633 GTGAAGAAGAAGGTGGAGGTTGG - Intergenic
929450844 2:42035993-42036015 GTGAATAAAACGATGAATGCTGG - Intergenic
929485802 2:42353098-42353120 TTAAAGAAAAAGAAGGAGGGTGG + Intronic
929635971 2:43521158-43521180 GGGAAGGAAAGGAGGGAGGGAGG + Intronic
930261981 2:49157662-49157684 GGGAAGAAAAGGAGGAAGGGAGG - Intergenic
931381269 2:61755682-61755704 ATGAGGAGAACCATGGAGGGTGG - Intergenic
932108080 2:68967325-68967347 GTGAAGACAAAGATGGAAGATGG + Intergenic
932464046 2:71902024-71902046 GTGAAGGAAGGGAGGGAGGGAGG - Intergenic
933067646 2:77818350-77818372 GAAAAGAAAAGGAGGGAGGGAGG - Intergenic
933067668 2:77818488-77818510 GGAAAGAAAAGGAGGGAGGGAGG - Intergenic
933215334 2:79623457-79623479 GGGAAGAAATAGATGGAGTGAGG - Intronic
933707401 2:85302275-85302297 GTGAGGGGAGCGATGGAGGGTGG + Intronic
935282812 2:101533800-101533822 GGAAAGAAAACAATGGAGGCAGG - Intergenic
935717720 2:105953520-105953542 GTGAAGAAACCAACGAAGGGAGG - Intergenic
936339748 2:111620739-111620761 GGGAAGGAAAGGAAGGAGGGAGG - Intergenic
937256482 2:120559748-120559770 GCGAAGACAAAGAGGGAGGGTGG - Intergenic
937830082 2:126410147-126410169 GTGGAGAAAACGTCTGAGGGAGG - Intergenic
938380435 2:130833461-130833483 GAAAAGAAAAGGAGGGAGGGAGG + Intergenic
938643371 2:133306124-133306146 TCCAAGAAAACAATGGAGGGTGG + Intronic
939069451 2:137521489-137521511 GAGAAGAAAAAGAGGGATGGGGG - Intronic
939179093 2:138783089-138783111 GAGAAGAAAAGGATGAAGAGAGG + Intergenic
939416558 2:141906069-141906091 GGGAAGAAAATGAGGGATGGAGG + Intronic
940318241 2:152347161-152347183 CTGAAGAACAAGAGGGAGGGAGG - Intronic
940372921 2:152922683-152922705 AAGAAGAAAGGGATGGAGGGAGG - Intergenic
940745210 2:157559966-157559988 AGGAAGAAAAGGAGGGAGGGAGG + Intronic
941770167 2:169336641-169336663 GTGGAGAATACTTTGGAGGGTGG - Intronic
941932651 2:170957570-170957592 ATGAAGAAAAGGAAGGAGGCTGG - Intronic
942497159 2:176551880-176551902 TAGAAGAAAAAGATGGAGGAAGG + Intergenic
942800547 2:179870309-179870331 GTCAAGAATACTATGGAGGAAGG - Intergenic
943229458 2:185229394-185229416 GTAAAGAAAAAGAAAGAGGGAGG + Intergenic
944094056 2:195946722-195946744 GTGAAGAGAAGGAGGAAGGGAGG - Intronic
944932344 2:204532639-204532661 GTGTGGAAAAGGGTGGAGGGTGG - Intergenic
945648227 2:212528066-212528088 CTGAAGAATACAATGGAGGAGGG + Intronic
948071093 2:235126774-235126796 TTGCAGAAGACGATGGTGGGTGG + Intergenic
948109388 2:235442343-235442365 GTGAAGGCAGCCATGGAGGGAGG - Intergenic
948555167 2:238804574-238804596 GTGAAGCAAAGAATGGAGGAGGG - Intergenic
948556470 2:238814647-238814669 GTGAACGAACCGGTGGAGGGTGG + Intergenic
1169950435 20:11037653-11037675 GTTAAGAGAAGGAGGGAGGGAGG + Intergenic
1169958354 20:11131019-11131041 GGGAAGAAAAAGTTGGGGGGTGG + Intergenic
1170442365 20:16391703-16391725 GAGAAGAAACCAAGGGAGGGTGG + Intronic
1170540384 20:17381753-17381775 GTGGAGAAAAAAAGGGAGGGTGG - Intronic
1170811952 20:19680975-19680997 GGCCAGTAAACGATGGAGGGGGG + Intronic
1172554731 20:35831148-35831170 GAGAAGGAAAGGAGGGAGGGAGG - Intronic
1173189396 20:40864641-40864663 CTGAAGGAAGGGATGGAGGGAGG + Intergenic
1173675467 20:44831277-44831299 GGGAAGGAAATGAGGGAGGGAGG - Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173790002 20:45822401-45822423 GGGAAGAAAGAGAGGGAGGGAGG + Intergenic
1175332533 20:58175256-58175278 GAGAAGGAAAAGAGGGAGGGAGG + Intergenic
1175482581 20:59321911-59321933 GTTAAGAAAAAGATGGAGTAAGG - Intronic
1176524174 21:7852775-7852797 GGGAAAAAAGCGAGGGAGGGTGG + Intergenic
1176994099 21:15534041-15534063 ATGAAGAAAACCAAGGAGTGAGG - Intergenic
1177637492 21:23806588-23806610 AGGAAGAAAACGAAGGAAGGAGG + Intergenic
1178103402 21:29294355-29294377 GTCAAGAAAATATTGGAGGGGGG - Intronic
1178481086 21:32979593-32979615 GAAATGAAAAGGATGGAGGGAGG + Intergenic
1178658194 21:34482788-34482810 GGGAAAAAAGCGAGGGAGGGTGG + Intergenic
1178882936 21:36462984-36463006 GGGAAGAAGAGGAGGGAGGGAGG + Intronic
1179276540 21:39897068-39897090 ATGAAGAAAATGAGGGAGGTAGG - Intronic
1179404301 21:41112686-41112708 GGGAAGAAAAGAAGGGAGGGAGG + Intergenic
1180339275 22:11605484-11605506 AGGGAGAAAGCGATGGAGGGAGG - Intergenic
1181148347 22:20864801-20864823 GGGAAGGAAAGGAAGGAGGGAGG + Intronic
1181824894 22:25507149-25507171 ATGAATAAAAGGATGGAGGATGG - Intergenic
1184345424 22:43909944-43909966 GGGAAGGAAAGGAGGGAGGGAGG + Intergenic
1184925763 22:47636076-47636098 GTGAAGAACAAGATGCAGAGAGG - Intergenic
1203290053 22_KI270735v1_random:28005-28027 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
949569376 3:5277257-5277279 GTGAAGAAAAAGATGTAGCGAGG + Intergenic
950329016 3:12141217-12141239 ATGAAGCAAAGGATGGAGGAAGG - Intronic
950474230 3:13205631-13205653 GTGAAGAGATGGATGGATGGAGG - Intergenic
950551283 3:13667616-13667638 GTGGAGAAAAAGATAGATGGTGG - Intergenic
950624503 3:14234925-14234947 GTGATGAAACTGAGGGAGGGAGG + Intergenic
950822304 3:15773933-15773955 GTGAAGTAATCAAGGGAGGGTGG + Intronic
952089253 3:29864864-29864886 GGGAAGAGAAGGAGGGAGGGAGG + Intronic
952274595 3:31865065-31865087 GAGAAGAAAAGAAGGGAGGGAGG + Intronic
952998708 3:38910009-38910031 GGAAGGAAAAGGATGGAGGGAGG + Intronic
953614837 3:44480584-44480606 CTGCAGAAAAAGATGGAGGGTGG - Intergenic
954429143 3:50459958-50459980 GTGCTGAAGAGGATGGAGGGTGG - Intronic
954922675 3:54205145-54205167 GTGAGGATAACAATAGAGGGGGG + Intronic
955014591 3:55057752-55057774 GGGAAGAAAAAAATGGAGGTGGG - Intronic
956009798 3:64818374-64818396 GTGAAGAAAAGAATGGGAGGTGG - Intergenic
956075244 3:65498045-65498067 GTGGAGAAAAGGACCGAGGGAGG + Intronic
959219203 3:103494526-103494548 ATGAAGGAAAGAATGGAGGGAGG + Intergenic
960883238 3:122367161-122367183 GTGAAGAGAAGGAGAGAGGGAGG + Intronic
962389466 3:134959187-134959209 GTGAAGAAAACGATGGCATTAGG - Intronic
963156289 3:142100671-142100693 GTGAAGAAAGGGAAGGAGGCAGG - Intronic
964282129 3:155079202-155079224 AAAAAGAAAACGAAGGAGGGAGG + Intronic
965640984 3:170828813-170828835 GAGAAGAAACAGAGGGAGGGAGG + Intronic
966451731 3:180071005-180071027 GTGAAGAAAAGGGTGGAAAGCGG - Intergenic
966863829 3:184245333-184245355 ATGAAGAAAAAGACGAAGGGAGG + Exonic
966869162 3:184278711-184278733 GGGAAGAAAGGGAGGGAGGGAGG - Intronic
967487832 3:190054863-190054885 ATGGAGAACAAGATGGAGGGGGG - Intronic
967875617 3:194266534-194266556 TAGAAGATAAAGATGGAGGGAGG + Intergenic
968020068 3:195378045-195378067 GTGAAAAAGAAGAGGGAGGGAGG + Intronic
968914196 4:3490061-3490083 GTGAAGAAAGGAATGGGGGGAGG - Intronic
969032133 4:4223977-4223999 GTGGAGAGAAGGATGGAGGAAGG + Intronic
969355516 4:6623059-6623081 GTCAAGAAGACTATGGAGGCTGG + Exonic
969538766 4:7772872-7772894 CTGAAGAAAGCGCTGGCGGGCGG - Exonic
970500608 4:16672965-16672987 AAGAAGGAAAGGATGGAGGGAGG - Intronic
971274279 4:25181089-25181111 GTGAAGACAAAGATAGAGAGTGG + Intronic
972361399 4:38328707-38328729 GGGAGGAAAAAGAAGGAGGGAGG - Intergenic
972369450 4:38408883-38408905 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
972480347 4:39490664-39490686 GGGAAGAAAAAGATGGAAGCAGG - Intergenic
972796095 4:42421192-42421214 ATGAAGAAAAAGGTGGAGGGAGG + Intronic
973133210 4:46673966-46673988 CTGAAGAAAACGAGGTAGGCAGG - Intergenic
975957023 4:79853358-79853380 GTAAAGAAAAAGTTGGAGGTAGG - Intergenic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
977763577 4:100771112-100771134 GGGAAGAAAGGGAGGGAGGGAGG + Intronic
978234575 4:106443265-106443287 GAGAAGAGAAGGAGGGAGGGAGG - Intergenic
978286710 4:107086402-107086424 AGGAAGAAAAGAATGGAGGGAGG + Intronic
978499961 4:109399074-109399096 GAGAAGAGAAAGAGGGAGGGAGG + Intergenic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
980121188 4:128730221-128730243 GGGAAGAGAAGGAAGGAGGGAGG - Intergenic
980400481 4:132277703-132277725 GGGAAGAAAACGATGGAAACAGG - Intergenic
981064925 4:140473142-140473164 AAGAAGGAAAAGATGGAGGGAGG - Intronic
982156728 4:152530566-152530588 GTGATGAAAACTATGGATTGAGG - Intronic
983289124 4:165779197-165779219 GTGAAGAAAAAGATGTATGTTGG - Intergenic
984542693 4:181060354-181060376 GGGAAGAAAAGGATGGGGGTAGG - Intergenic
984671196 4:182489838-182489860 GGGAAGAAAAGGAAGGAGGGAGG - Intronic
984745141 4:183207972-183207994 TCCAAGAAAACAATGGAGGGGGG + Exonic
985375637 4:189334592-189334614 GTGAAGAGAAGGATGGGGAGAGG - Intergenic
986428695 5:7660201-7660223 AGAAAGAAAAGGATGGAGGGAGG + Intronic
986764611 5:10913491-10913513 GGGAAGGAAAAGAGGGAGGGAGG + Intergenic
986770461 5:10968215-10968237 GTGAAGGAGAAGATGGAGGAAGG - Intergenic
987005098 5:13702722-13702744 GTGATGAGAGGGATGGAGGGTGG + Intronic
987723280 5:21664987-21665009 GTGAATATAAGGCTGGAGGGAGG - Intergenic
988262229 5:28902651-28902673 GTGAATAAAACTATGAAGTGAGG - Intergenic
989644149 5:43611103-43611125 GTAAAGAAAAAGAGGGAGGGAGG - Intronic
989791109 5:45402881-45402903 GAAAAGAAAAGGAGGGAGGGAGG - Intronic
990908807 5:60833076-60833098 TTGTAGACAAAGATGGAGGGGGG + Intronic
991922638 5:71671916-71671938 GTGAAGAGAGCATTGGAGGGCGG - Intergenic
992792775 5:80228257-80228279 GGGAAGGAAAGGAGGGAGGGAGG + Intronic
992949548 5:81844811-81844833 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
993915966 5:93742511-93742533 GTGCAGAAAGCTAAGGAGGGAGG + Intronic
994270059 5:97766328-97766350 GTGAATAAAACCATGGGAGGTGG + Intergenic
994520234 5:100824652-100824674 CTGAAAAAAAAGGTGGAGGGGGG + Intronic
995484668 5:112628305-112628327 GTGCTGAAAAGGAGGGAGGGAGG - Intergenic
996249300 5:121308664-121308686 GTGAAGAAAACCAAGAAGGCTGG + Intergenic
996307588 5:122067380-122067402 GTGAGGAAAATGAAGGAGAGAGG + Intronic
997035677 5:130188690-130188712 ATGTAGAAAACAACGGAGGGGGG + Intergenic
997420519 5:133763415-133763437 GTCAAGAAAACCAAGGAAGGAGG - Intergenic
998534108 5:142913396-142913418 GAGAAGGAAAGGAAGGAGGGAGG - Intronic
999572102 5:152930699-152930721 GTGAAGAAAAAGCTTGAAGGAGG + Intergenic
999802814 5:155053556-155053578 GAGGAGAAGAGGATGGAGGGCGG + Intergenic
1000132109 5:158310025-158310047 GGGAAGGAAAGGAGGGAGGGAGG - Intergenic
1001104713 5:168843285-168843307 GTGAAGAGGAAGGTGGAGGGAGG + Intronic
1001234217 5:170015809-170015831 AAGAAGAAAAGGAGGGAGGGAGG - Intronic
1001234224 5:170015834-170015856 AAGAAGAAAAGGAGGGAGGGAGG - Intronic
1002606316 5:180385051-180385073 GGGAAGAAGAGGATGGGGGGAGG + Intergenic
1002899508 6:1399259-1399281 GAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1003107612 6:3227944-3227966 GTGAAGAAAAGGAGGGTGAGAGG + Intronic
1003443504 6:6164776-6164798 GAGGAGAAAAGGATGGAGGGAGG - Intronic
1005845441 6:29773373-29773395 GGGAAGAGAAGGAGGGAGGGAGG - Intergenic
1005850767 6:29819055-29819077 GAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1005865806 6:29935136-29935158 GAGAAGAAAGAGATGGAGGGAGG - Intergenic
1005942381 6:30570376-30570398 CTGAAGAAAACAAAGGAGGGAGG + Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006702125 6:35983980-35984002 GTGAGGAAAATGAGAGAGGGAGG - Intronic
1006806561 6:36793060-36793082 GTGAAGTAAAGGGTGCAGGGAGG - Intronic
1006943547 6:37769043-37769065 TTGAACAAAACAATGGAGGAAGG + Intergenic
1007692318 6:43710555-43710577 GAGAAGAAATGGAGGGAGGGAGG + Intergenic
1011090688 6:83595581-83595603 GAGAAGAAAACCCTGGAGAGTGG + Intronic
1011575008 6:88787681-88787703 GTGAAGAAAAGATTGGAGGGAGG + Intronic
1011745346 6:90402926-90402948 AGGAAGAAAGGGATGGAGGGAGG - Intergenic
1012149889 6:95735514-95735536 GTGAAGAAAAACATAGAGGGTGG - Intergenic
1012398061 6:98822520-98822542 GTGAGGAAAGGGCTGGAGGGTGG + Intergenic
1013260262 6:108434606-108434628 GTTGGGAAAACAATGGAGGGGGG - Intronic
1013300852 6:108803772-108803794 GTGAAGAAAGTGTTTGAGGGAGG + Intergenic
1015567433 6:134588015-134588037 GAAAAGAAAAGGAGGGAGGGAGG + Intergenic
1016189537 6:141246634-141246656 CAGAACAAAACGATGGAGGGAGG + Intergenic
1016194321 6:141314420-141314442 CTGAAGAAAACACTGGAGAGAGG - Intergenic
1016374592 6:143407322-143407344 GTGAAGAAAATTATAGAGGTAGG - Intergenic
1016678451 6:146799610-146799632 GGGAAGAAAGGGAGGGAGGGAGG + Intronic
1016802646 6:148182357-148182379 ATAAAGAAAAAGAGGGAGGGAGG + Intergenic
1017209875 6:151843401-151843423 GACAAGAAAACAATGGAGGCAGG - Intronic
1017248106 6:152249696-152249718 AAGAAGAAACTGATGGAGGGAGG - Intronic
1018031758 6:159846625-159846647 GTGAGGAAAAAGATGGGAGGAGG + Intergenic
1018457054 6:163962092-163962114 GTGAAGAAAGGGAGGCAGGGCGG + Intergenic
1018614001 6:165668796-165668818 GGGAAGGAAAGGAGGGAGGGAGG + Intronic
1019147058 6:169982259-169982281 GGGAAGGAAAGGAGGGAGGGGGG + Intergenic
1020444460 7:8254889-8254911 GGGAAGAAAACCCTGCAGGGTGG + Intronic
1023288602 7:38645269-38645291 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
1023353993 7:39349310-39349332 GTGAAGAAAAGGAAGGAAGAAGG - Intronic
1023584403 7:41714301-41714323 GGGCAGAAAAAGAGGGAGGGAGG + Intergenic
1023623554 7:42095586-42095608 GAGAAGAGAAAGATGGAAGGTGG + Intronic
1023986389 7:45099595-45099617 GTGAAGACAACGATGGAGTTTGG + Intergenic
1024278872 7:47701507-47701529 AAGAAGAAAAGGAAGGAGGGAGG + Intronic
1024805237 7:53131941-53131963 AGGAAGAAAAGGAGGGAGGGAGG - Intergenic
1024850955 7:53716426-53716448 GTGAGGAAGAAGTTGGAGGGTGG - Intergenic
1025150911 7:56548624-56548646 GGGAAGAAAAAGATTAAGGGAGG + Intergenic
1025307744 7:57879335-57879357 AGGAAGAAAAGGAGGGAGGGTGG - Intergenic
1025737919 7:64169567-64169589 GGGAAGAAAAAGATTAAGGGAGG - Intronic
1025766177 7:64453629-64453651 GGGAAGAAAAAGATTAAGGGAGG - Intergenic
1025800433 7:64781785-64781807 CTGAAGAAAATAATGGAGGATGG + Intergenic
1026236576 7:68532501-68532523 GAGAAGGAAAGGAAGGAGGGAGG - Intergenic
1026345641 7:69471590-69471612 GAAAAGAAAACGAGGGAGTGGGG + Intergenic
1026382422 7:69812916-69812938 GTGAAGAACACTCTGCAGGGAGG - Intronic
1027469769 7:78558631-78558653 GTGAAGAAACTGAAGGATGGAGG - Intronic
1028051537 7:86193946-86193968 GTGAAGAGAAGGAGGGAGGAAGG + Intergenic
1028285189 7:88987969-88987991 GAGAAGAAAAGGAAGGAGGAGGG - Intronic
1030552285 7:110977676-110977698 AGGAAGAAAAGGAGGGAGGGAGG - Intronic
1030875623 7:114809890-114809912 GGGAGGAAAAGGAGGGAGGGAGG + Intergenic
1030945924 7:115720153-115720175 GTGAAGAAAAGGAAGCAAGGGGG + Intergenic
1031335259 7:120522110-120522132 GTGGAGAAAACCATAAAGGGAGG - Intronic
1033789386 7:144773271-144773293 CTGAAGAAAGGGATGGAGGGAGG + Intronic
1034855783 7:154545424-154545446 ATGAAGAAAAGGAGGGAGGGAGG - Intronic
1035895423 8:3394617-3394639 GTGTAGAAAAAGTTGGGGGGAGG + Intronic
1036048067 8:5166117-5166139 GGAAAAAAAATGATGGAGGGAGG + Intergenic
1036048810 8:5173025-5173047 GTGAAGAATGCTATGGAGAGAGG + Intergenic
1036071059 8:5441015-5441037 CAGAAGAAAATAATGGAGGGGGG + Intergenic
1038070314 8:24006184-24006206 GGGAAGGAAAGGAGGGAGGGAGG - Intergenic
1038364611 8:26918448-26918470 TTGAAGATAAAGATGGAGAGTGG - Intergenic
1038476935 8:27875202-27875224 GTGAAGAGAGGGAGGGAGGGAGG - Intronic
1039378923 8:37066820-37066842 GGGAAGAAGAGGATGGAGGAGGG + Intergenic
1040835237 8:51724013-51724035 GTGCAGAAAAGGAAAGAGGGAGG + Intronic
1041146476 8:54881385-54881407 GTGCAGAAAACACTGCAGGGTGG - Intergenic
1041444143 8:57931777-57931799 GGGAAGGAAAAGAAGGAGGGAGG + Intergenic
1041861556 8:62519216-62519238 GTCAAGGAAAAGATGGAAGGAGG + Intronic
1042810605 8:72821812-72821834 GTGAAGGGAAGGATGGAGGGAGG + Intronic
1042828641 8:73003443-73003465 GGGAAGGAAAGGAGGGAGGGAGG + Intergenic
1044224242 8:89701384-89701406 ATGAAGAAAATGATGGACAGTGG - Intergenic
1045113878 8:98961059-98961081 GTGAAGAAAGAGATGAATGGGGG + Intergenic
1045369255 8:101505186-101505208 ATGAAGAAAAGGATGGGGGAGGG - Intronic
1045467404 8:102483254-102483276 AAGAAGAAAAGGAGGGAGGGAGG - Intergenic
1045616345 8:103917338-103917360 CTGAAGAAAACGACTTAGGGTGG + Intronic
1047707468 8:127514232-127514254 ATGAAGCAAAAGATGGAGGGAGG + Intergenic
1047837873 8:128714337-128714359 ATGTAAAAAACAATGGAGGGAGG + Intergenic
1049012898 8:139899455-139899477 GTGAAGATAAGGATGAAGGATGG - Intronic
1049584995 8:143428949-143428971 GAGAAGAGAACGAAGGAGGGCGG + Exonic
1050666170 9:7938876-7938898 GTGGAAAAATCGGTGGAGGGGGG + Intergenic
1053532038 9:38892026-38892048 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054204263 9:62116435-62116457 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054634100 9:67471929-67471951 GAGAACAAAAAGATGGAGGAAGG - Intergenic
1055305670 9:74926711-74926733 GTAAAGAAAACAAAGCAGGGAGG + Intergenic
1056719261 9:89058998-89059020 GTGTAGGACATGATGGAGGGCGG + Intronic
1056835794 9:89954157-89954179 GTCAAGAAAAATAAGGAGGGGGG - Intergenic
1056869741 9:90266342-90266364 AGGAAGGAAAGGATGGAGGGAGG - Intergenic
1057642908 9:96844574-96844596 GTGGAGGAAGGGATGGAGGGAGG + Intronic
1059929899 9:119250095-119250117 AGGAAGAAAAGGAAGGAGGGAGG + Intronic
1061673880 9:132204427-132204449 GGGAAGAAAACCATGGAGGGTGG + Intronic
1061845185 9:133383986-133384008 ATGAAGAGAAGGCTGGAGGGAGG + Intronic
1062670276 9:137704804-137704826 AGGAAGAAAAGGAGGGAGGGAGG - Intronic
1203549747 Un_KI270743v1:157355-157377 GTGAAGGAAATGGTGGAGGGTGG - Intergenic
1203581748 Un_KI270746v1:13153-13175 AGGAAGAAAAGGAGGGAGGGAGG + Intergenic
1185602303 X:1348783-1348805 GTGAAGAAAAGAAAGAAGGGAGG - Intronic
1185667823 X:1781368-1781390 GAGAAAGAAACGAGGGAGGGAGG + Intergenic
1185708494 X:2282759-2282781 GGGGAGAAAGCGAGGGAGGGAGG + Intronic
1185861535 X:3583914-3583936 GTGAAGAAAGGAAGGGAGGGAGG + Intergenic
1186489421 X:9959774-9959796 GGGAGGAAAAGAATGGAGGGAGG - Intergenic
1187552955 X:20324201-20324223 GAGAAGAGAAGGAGGGAGGGAGG - Intergenic
1187804218 X:23100570-23100592 GTGAAGAAAATGAGGGTGGTGGG - Intergenic
1188287596 X:28346956-28346978 GGAAAGAAAAAGAGGGAGGGAGG + Intergenic
1190765576 X:53473172-53473194 CTGAAGAAAATGAAGCAGGGAGG + Intergenic
1191607445 X:63078184-63078206 GAGAAGAAAACCATGTATGGAGG - Intergenic
1191967362 X:66774527-66774549 AGGAAGAAAAGGAAGGAGGGAGG - Intergenic
1192550919 X:72052801-72052823 GTGAAGAAAGGGGTGGAGAGAGG - Intergenic
1193490382 X:82142482-82142504 GAGAAGAAAAAGAAGGAGAGTGG - Intergenic
1195431079 X:104790247-104790269 GGGAAGAAAAAGATGGATGCTGG + Intronic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1196766665 X:119252225-119252247 GGGAAGAAACGGATGGGGGGTGG - Intergenic
1196929146 X:120663617-120663639 TAGAAGAAAAGGAGGGAGGGAGG - Intergenic
1198242000 X:134796502-134796524 GGGAAAACAAGGATGGAGGGAGG + Intronic
1199396152 X:147341103-147341125 GGGAAGGAAACGAGGGAGGGAGG - Intergenic