ID: 1147460122

View in Genome Browser
Species Human (GRCh38)
Location 17:40562997-40563019
Sequence GGCCCATTGCAGCTCCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147460115_1147460122 18 Left 1147460115 17:40562956-40562978 CCTCTGATGGCAATGGAGTTTGC 0: 1
1: 1
2: 3
3: 10
4: 129
Right 1147460122 17:40562997-40563019 GGCCCATTGCAGCTCCTTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 153
1147460113_1147460122 27 Left 1147460113 17:40562947-40562969 CCTTGTCGGCCTCTGATGGCAAT 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1147460122 17:40562997-40563019 GGCCCATTGCAGCTCCTTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 153
1147460119_1147460122 -9 Left 1147460119 17:40562983-40563005 CCTGCCACATCCTGGGCCCATTG 0: 1
1: 0
2: 0
3: 25
4: 219
Right 1147460122 17:40562997-40563019 GGCCCATTGCAGCTCCTTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 153
1147460118_1147460122 -4 Left 1147460118 17:40562978-40563000 CCATTCCTGCCACATCCTGGGCC 0: 1
1: 0
2: 6
3: 44
4: 498
Right 1147460122 17:40562997-40563019 GGCCCATTGCAGCTCCTTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147460122 Original CRISPR GGCCCATTGCAGCTCCTTGT TGG Intronic
901332991 1:8424664-8424686 GGCAGACTGCAGCTCCTTGAGGG - Intronic
903283682 1:22264303-22264325 TGGCCATGGCAGCTCCTTCTAGG + Intergenic
903740608 1:25556411-25556433 GGCCCACTGGGGCTCCTTGTTGG + Intronic
905276459 1:36821695-36821717 GCCCCATGGCATCTCCCTGTTGG - Intronic
908717681 1:67087615-67087637 CGCCCATTGCAGCTCCCGTTTGG + Intergenic
909992540 1:82240418-82240440 TGCCCTGTGCAGCTCCTGGTGGG + Intergenic
911566022 1:99464467-99464489 GGGCCATGGCAGCTCCTTCATGG + Intergenic
911725837 1:101239925-101239947 GGCCCGACGCATCTCCTTGTTGG - Exonic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
918120645 1:181536837-181536859 TGCCCATTGCCCCTGCTTGTGGG + Intronic
919568678 1:199220216-199220238 GTGCCACTGCAGCTGCTTGTAGG - Intergenic
924826876 1:247549044-247549066 GGCCCCTGGCAGCTCGTGGTTGG + Intronic
1066064634 10:31753137-31753159 GACCCAATGCAGCTCCTAGCAGG - Intergenic
1066441243 10:35441096-35441118 GCCCCATTCTAGCTCCTTATGGG - Intronic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1069897791 10:71689630-71689652 AGCCCAGTGGAGCTCCCTGTGGG + Intronic
1070064409 10:73019002-73019024 GCACCATGGCAGCTGCTTGTAGG + Intronic
1070483493 10:76908357-76908379 GGACCATTTTATCTCCTTGTTGG + Intronic
1070761826 10:79028714-79028736 TGGCCATTGCTGCTCCTTGAGGG - Intergenic
1074051441 10:109884427-109884449 GGATCATTTCAACTCCTTGTGGG - Intronic
1074542265 10:114374722-114374744 GGCCCCTTCCAGCTCTTAGTTGG - Intronic
1075527613 10:123199625-123199647 GCCCCATTACAGCCCCTTGGAGG - Intergenic
1076344504 10:129771231-129771253 CCCCCATTACAGATCCTTGTCGG - Intergenic
1076424313 10:130356691-130356713 TGCCCATTGCTGCTCCTGATCGG + Intergenic
1079857521 11:25624681-25624703 CGCCCATTGCCGCTCCTGATTGG + Intergenic
1080896478 11:36452545-36452567 GGCCCATTCCAGCTCCTGGGAGG - Intronic
1082766720 11:57174649-57174671 GGCAGAATTCAGCTCCTTGTGGG + Intergenic
1083596599 11:63920709-63920731 GGACCATGGCAGCTCCCTCTGGG + Intergenic
1087614252 11:100470170-100470192 GGCTCATTGCCTCTCCCTGTGGG + Intergenic
1089099708 11:115952377-115952399 GGTCCATCCCAGCTCCTGGTCGG - Intergenic
1092078259 12:5691392-5691414 AGACCATTGCAGGTCCTGGTAGG + Intronic
1097893536 12:64802135-64802157 AGCCCATTACAGCTCTTTTTTGG + Intronic
1100370980 12:93968361-93968383 GCCCAATTGCAGCTCACTGTAGG - Intergenic
1101535474 12:105612558-105612580 GGCCCATTGCAGCTTCTCTGAGG - Intergenic
1103593281 12:122007373-122007395 GGCCAATGGCAGGTCCTTATAGG + Intergenic
1106393736 13:29360358-29360380 GTCCCCTGGCAGCTCCTTTTTGG + Intronic
1106958883 13:34974283-34974305 GCACCATTGCTGCTTCTTGTTGG + Intronic
1107427218 13:40306160-40306182 CACCCATTGAAGCTCCTGGTTGG - Intergenic
1109520615 13:63505488-63505510 CGCCCATTGCCGCTCCTGATCGG - Intergenic
1112434225 13:99379951-99379973 GGCCCCATGCAGGTCATTGTGGG + Intronic
1116749113 14:48860166-48860188 GGTCCTTTGCAGTTCCATGTAGG - Intergenic
1118262525 14:64260675-64260697 GGCACAGTGCAGCTGCTCGTCGG + Exonic
1118453500 14:65925159-65925181 TGCCCATTGCCGCTCCTGATAGG - Intergenic
1121604458 14:95230455-95230477 GTCCCATTACAGCCTCTTGTGGG - Intronic
1125539062 15:40459312-40459334 GGCCATCTGCAACTCCTTGTGGG + Exonic
1126219697 15:46197956-46197978 TGCCCTGTGCAGCTCCTTGGTGG + Intergenic
1126925474 15:53580515-53580537 GGCCCACTGCAGCTACTTCCTGG + Intronic
1128363093 15:66976386-66976408 CGCCCATTGCCGCTCCTGATTGG - Intergenic
1133305333 16:4804728-4804750 GGCCCAAGGCCTCTCCTTGTAGG + Exonic
1135402892 16:22178378-22178400 GGCCCCTTGGAGCTCCTGGCAGG + Intronic
1135913156 16:26579261-26579283 GGCACATAGCAGCTACTTGGTGG - Intergenic
1136702885 16:32159373-32159395 GGGACATTGTAGCTACTTGTTGG - Intergenic
1136704080 16:32171576-32171598 GGACCACTGCAGCTCCCAGTGGG - Intergenic
1136763829 16:32757830-32757852 GGACCACTGCAGCTCCCAGTGGG + Intergenic
1136764814 16:32768223-32768245 GGGACATTGTAGCTACTTGTTGG + Intergenic
1136803285 16:33102161-33102183 GGGACATTGTAGCTACTTGTTGG - Intergenic
1136804270 16:33112556-33112578 GGACCACTGCAGCTCCCAGTGGG - Intergenic
1141202041 16:81905544-81905566 CGCCCCTTGCAGCTGCTTCTTGG + Intronic
1203065976 16_KI270728v1_random:1018152-1018174 GGACCACTGCAGCTCCCAGTGGG + Intergenic
1203067171 16_KI270728v1_random:1030348-1030370 GGGACATTGTAGCTACTTGTTGG + Intergenic
1143862998 17:9904866-9904888 GGCCCACTCCAGCTTCTGGTTGG + Exonic
1147460122 17:40562997-40563019 GGCCCATTGCAGCTCCTTGTTGG + Intronic
1148866501 17:50631473-50631495 AGCCCCTTGCGGCTCCTTGGAGG - Intergenic
1151714625 17:75825125-75825147 GGGCCCTTGAAGCTCCTTGAGGG + Exonic
1156258409 18:35422045-35422067 GTGTCATTGCAGCTGCTTGTAGG - Intergenic
1156986180 18:43353729-43353751 TTCCCTTTGCAGCTCCTTGTAGG + Intergenic
1157578292 18:48758478-48758500 GGCACAGTGCAGAGCCTTGTGGG + Intronic
1158423738 18:57320413-57320435 GGCCCCTTGCAGCACCTAATGGG + Intergenic
1160007402 18:75077343-75077365 GGCTGATTGAAGCTCTTTGTGGG - Intergenic
1160532594 18:79574235-79574257 GTCCCATTGCAGCTCGTGGGAGG - Intergenic
1161533432 19:4804075-4804097 GGCTCATTGCGGCACCTTCTGGG + Intergenic
1163605830 19:18274796-18274818 GGCCCGTTGCACCCCCTTTTTGG - Intergenic
1164489482 19:28693389-28693411 GGCACATTGCAGCTCCTAGCTGG - Intergenic
1168645665 19:58057513-58057535 GGCCCCTCTCAGCTCCTTCTTGG - Intergenic
925087346 2:1118220-1118242 GTGCCACTGCAGCTGCTTGTGGG + Intronic
931025808 2:58112800-58112822 GGGACATTGCAGCACATTGTGGG + Intronic
931038994 2:58275848-58275870 CGCCCATTACAGCTCCCAGTCGG + Intergenic
931567383 2:63628870-63628892 AGCCCATTCCAGCTCCAAGTTGG - Intronic
932023772 2:68113768-68113790 GGCTCACTGCAGCTCCTCTTAGG - Intergenic
936489216 2:112956173-112956195 GGCTCATTGTGGCTCCTTGCAGG - Intergenic
940186246 2:150987034-150987056 GCACCACTGCAGCTACTTGTAGG + Intergenic
944542592 2:200767713-200767735 GCCCCACTGCAGCTCCTTTCTGG - Intergenic
945395015 2:209306683-209306705 CGCCCATTGCCGCTCCTGATCGG + Intergenic
946402590 2:219476436-219476458 GGCCCAATGCTGCCCCCTGTGGG - Intronic
948165048 2:235854561-235854583 GGCCCATTTCAGCGCATTATAGG + Intronic
948242793 2:236452314-236452336 GGCCCGTTGAAGCTCAGTGTTGG - Intronic
1168958135 20:1848937-1848959 GGCCCATTCCTGCTCTTAGTGGG - Intergenic
1172109069 20:32534948-32534970 GTCTCATTTCAGCTCCTGGTGGG + Intronic
1172112415 20:32554848-32554870 GCCCCATGCCAGCTCCTAGTAGG - Intronic
1172870292 20:38131423-38131445 GCCTCATTGCAGCTCCATGCAGG - Intronic
1173810737 20:45953646-45953668 GGCCCCTTTCAGCTTTTTGTAGG - Intronic
1175627213 20:60499643-60499665 GGCCTCTTCCAGCTCCCTGTTGG + Intergenic
1176360685 21:5994836-5994858 GCACCATGGCAGCTGCTTGTAGG - Intergenic
1177106777 21:16966761-16966783 GGACCATGGCAGCTGCTTGTAGG - Intergenic
1177263961 21:18760055-18760077 CGCCCATTGCTGCTCCTGATTGG - Intergenic
1179762833 21:43543714-43543736 GCACCATGGCAGCTGCTTGTAGG + Intronic
1179823240 21:43949406-43949428 GGTCCATTTCTGCTCCATGTGGG + Intronic
1183527878 22:38334769-38334791 GGCGCATATCCGCTCCTTGTGGG - Intronic
950270964 3:11614537-11614559 TGCCCACTGCAGCTCCGTGGGGG - Intronic
951016240 3:17735713-17735735 TGCCCATTGCTGCTCCTGATCGG - Intronic
951326056 3:21303037-21303059 CGCCCATTGCTGCTCCTGATGGG - Intergenic
953505915 3:43485358-43485380 CGCCCATTGCCGCTCCTGATCGG + Intronic
954213415 3:49111057-49111079 AGCACATTCCAGCTCCTTGGAGG + Exonic
955467003 3:59247767-59247789 GGCCCAAGGCATTTCCTTGTAGG - Intergenic
958630353 3:96674954-96674976 TGCCCATTGCCACTCCCTGTCGG - Intergenic
959436870 3:106326180-106326202 GGAGCATTGCTGCTCCTTCTAGG - Intergenic
963915329 3:150854468-150854490 GGCCCATTGCTGCTCCCAATTGG + Intergenic
965539974 3:169862244-169862266 GGCCATTTGCAGCTCCTTGATGG - Intronic
967413690 3:189194361-189194383 GCACCACTGCAGCTACTTGTAGG - Intronic
967493637 3:190120389-190120411 GCCCCTTTTCCGCTCCTTGTTGG - Exonic
969300511 4:6294446-6294468 GGCCCATGGCAGACACTTGTTGG + Intronic
975498885 4:75063035-75063057 GGCCCATTGCAGTTTTATGTGGG + Intergenic
976189307 4:82473792-82473814 GGCCCATTGCTGCTCCCAATCGG + Intergenic
980152101 4:129060773-129060795 GTGCCACTGCAGCTACTTGTAGG - Intronic
984731508 4:183072767-183072789 GGACCATTTCAACTCATTGTGGG - Intergenic
985937892 5:3110648-3110670 GGCACATGCCAGCTTCTTGTAGG - Intergenic
986971847 5:13346105-13346127 TGCACATTGCAGCTCCTTGCTGG - Intergenic
987152294 5:15055716-15055738 GTACCATTACAGCTGCTTGTTGG - Intergenic
987288831 5:16488445-16488467 GGCCCCTTGGATCTCCTTTTTGG - Intronic
987738489 5:21874786-21874808 TGCCCATTGCTGCTCCCAGTCGG + Intronic
992777920 5:80104542-80104564 GGCCCAGTTCAGTTCTTTGTGGG + Intergenic
996702161 5:126461212-126461234 GGCCCTTTGCCGCTCCTGCTGGG - Intronic
1001318252 5:170659901-170659923 GGCCCCTTGGAGCTCCTTCCAGG + Intronic
1001408620 5:171494925-171494947 GGCCCAGGGAAGCCCCTTGTAGG - Intergenic
1001942435 5:175750307-175750329 GGCCCCTTGCAGGTTCTGGTTGG - Intergenic
1005816670 6:29558682-29558704 CGCCCATTGCCGCTCCTGATTGG + Intronic
1007039044 6:38704433-38704455 GGCCAATCACAGCTCCTTCTTGG - Intergenic
1015808293 6:137133983-137134005 GGGCCACTGCAGCTGCTTGTAGG + Intergenic
1018503960 6:164443827-164443849 GGCCCACAGCAGCTACATGTGGG - Intergenic
1019750357 7:2725301-2725323 GGCCCAGGGCAGCCCCTTCTAGG - Intronic
1020448207 7:8292258-8292280 GGCCCAATGCAGGTCCTAGAGGG - Intergenic
1022989925 7:35696709-35696731 CGCCCATTGCTGCTCCTGATCGG + Intergenic
1024005066 7:45219393-45219415 GGCACCGTGCAGCTCCTTGTGGG + Intergenic
1024148002 7:46536692-46536714 TGCCCATTGCCGCTCCTGATCGG - Intergenic
1024640595 7:51325550-51325572 GGCTCAGTGCTGCTCCTTCTTGG - Intergenic
1030081963 7:105786017-105786039 GAACCATTGTAGCTCTTTGTGGG - Intronic
1031250856 7:119378857-119378879 GGCCCATTGCATCTCCAGATAGG - Intergenic
1032364512 7:131286805-131286827 GGCCCATTGGGGCTCCTTTTGGG - Intronic
1032492430 7:132333535-132333557 GCACCATTGCAGCTCCCAGTGGG - Intronic
1033655920 7:143374301-143374323 GGCCCATCCCAGCTTCTGGTTGG - Intergenic
1034249511 7:149676913-149676935 TGCCCATTGCCGCTCCTGATTGG + Intergenic
1034650826 7:152688769-152688791 CGCCCATTGCTGCTCCTGATTGG - Intergenic
1036752090 8:11449784-11449806 GGCCCACAGCGGCTCCTTGGAGG + Intronic
1038200124 8:25404163-25404185 GCCCCATGGCAGCTCTTTATAGG + Intronic
1040384298 8:46903283-46903305 GACCCAGGGCAGTTCCTTGTAGG + Intergenic
1042055672 8:64763173-64763195 CGCCCATTGCTGCTCCTGATCGG + Intronic
1042429115 8:68683921-68683943 AGCACAATGTAGCTCCTTGTTGG - Intronic
1043573266 8:81629328-81629350 GGTCCCTTACAGGTCCTTGTAGG + Intergenic
1044988274 8:97774105-97774127 TGCCCATTGCCGCTCCTGTTTGG - Intergenic
1047443546 8:124900049-124900071 TGCCCATTGCCGCTCCTGTTGGG - Intergenic
1049386453 8:142345294-142345316 GGCCCCTTCCAGGTCCTTCTGGG - Intronic
1049696518 8:143986642-143986664 GGCCCACTCCAGCCCCTGGTTGG + Intronic
1050593515 9:7183639-7183661 TGCCCATTGCTGCTCCTGATCGG + Intergenic
1053011680 9:34637326-34637348 CACCCACTGCAGCTCCTCGTCGG + Exonic
1062036034 9:134382979-134383001 GTCCCACTGCAGCCCCTTCTGGG - Intronic
1062212048 9:135370443-135370465 GGCGCATTTGAGCTCCATGTGGG + Intergenic
1187567270 X:20463698-20463720 AGCCAGTTGGAGCTCCTTGTGGG + Intergenic
1187590084 X:20707870-20707892 GGCCCATGCCTGCTCTTTGTGGG + Intergenic
1188256493 X:27967352-27967374 GGCAGTTTGCAGCTGCTTGTGGG - Intergenic
1190416419 X:50184514-50184536 GGCTCAGGGCTGCTCCTTGTTGG - Intergenic
1196287262 X:113897373-113897395 TGCCCATTGCCGCTCCTGATTGG - Intergenic
1197899695 X:131356951-131356973 GGCCCACTGCAGCTGCTGCTCGG - Intronic
1200072556 X:153536354-153536376 GGCCCCTCGCAGCTCCATGAGGG - Exonic
1201723810 Y:17132941-17132963 TGCCCATTGCCACTCCTAGTTGG - Intergenic