ID: 1147462078

View in Genome Browser
Species Human (GRCh38)
Location 17:40579478-40579500
Sequence CTGCAGTCAGTGTCCAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147462078_1147462082 10 Left 1147462078 17:40579478-40579500 CCTTTGTTGGACACTGACTGCAG No data
Right 1147462082 17:40579511-40579533 CGGCAGTAGCTTGAGTATCATGG No data
1147462078_1147462080 -10 Left 1147462078 17:40579478-40579500 CCTTTGTTGGACACTGACTGCAG No data
Right 1147462080 17:40579491-40579513 CTGACTGCAGATCCTGGTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147462078 Original CRISPR CTGCAGTCAGTGTCCAACAA AGG (reversed) Intergenic
No off target data available for this crispr