ID: 1147463876

View in Genome Browser
Species Human (GRCh38)
Location 17:40595142-40595164
Sequence ATGCCTATCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147463876_1147463877 2 Left 1147463876 17:40595142-40595164 CCTTCACTCTTCTAGATAGGCAT No data
Right 1147463877 17:40595167-40595189 TTTATTAGATCTTTTTTTCTTGG No data
1147463876_1147463878 18 Left 1147463876 17:40595142-40595164 CCTTCACTCTTCTAGATAGGCAT No data
Right 1147463878 17:40595183-40595205 TTCTTGGTTTAGAGTAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147463876 Original CRISPR ATGCCTATCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr