ID: 1147471507

View in Genome Browser
Species Human (GRCh38)
Location 17:40666429-40666451
Sequence TACCCACAGCTCCTGGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147471501_1147471507 25 Left 1147471501 17:40666381-40666403 CCAGTCTATGCTGGGCATTCTCA No data
Right 1147471507 17:40666429-40666451 TACCCACAGCTCCTGGTGAGAGG No data
1147471503_1147471507 -2 Left 1147471503 17:40666408-40666430 CCTCTCCAAACAAAGCTGTCCTA No data
Right 1147471507 17:40666429-40666451 TACCCACAGCTCCTGGTGAGAGG No data
1147471502_1147471507 -1 Left 1147471502 17:40666407-40666429 CCCTCTCCAAACAAAGCTGTCCT No data
Right 1147471507 17:40666429-40666451 TACCCACAGCTCCTGGTGAGAGG No data
1147471504_1147471507 -7 Left 1147471504 17:40666413-40666435 CCAAACAAAGCTGTCCTACCCAC No data
Right 1147471507 17:40666429-40666451 TACCCACAGCTCCTGGTGAGAGG No data
1147471500_1147471507 30 Left 1147471500 17:40666376-40666398 CCAGGCCAGTCTATGCTGGGCAT No data
Right 1147471507 17:40666429-40666451 TACCCACAGCTCCTGGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147471507 Original CRISPR TACCCACAGCTCCTGGTGAG AGG Intergenic
No off target data available for this crispr