ID: 1147477353

View in Genome Browser
Species Human (GRCh38)
Location 17:40724789-40724811
Sequence CTTTATCAGCAGGATGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147477351_1147477353 -7 Left 1147477351 17:40724773-40724795 CCAGTCTCAGGTACGTCTTTATC 0: 51
1: 1780
2: 4304
3: 8480
4: 10914
Right 1147477353 17:40724789-40724811 CTTTATCAGCAGGATGAGAGTGG No data
1147477348_1147477353 7 Left 1147477348 17:40724759-40724781 CCTTTATAAATTACCCAGTCTCA 0: 1925
1: 3198
2: 4070
3: 3254
4: 1860
Right 1147477353 17:40724789-40724811 CTTTATCAGCAGGATGAGAGTGG No data
1147477350_1147477353 -6 Left 1147477350 17:40724772-40724794 CCCAGTCTCAGGTACGTCTTTAT 0: 67
1: 3039
2: 7456
3: 11483
4: 10924
Right 1147477353 17:40724789-40724811 CTTTATCAGCAGGATGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147477353 Original CRISPR CTTTATCAGCAGGATGAGAG TGG Intergenic
No off target data available for this crispr