ID: 1147477902

View in Genome Browser
Species Human (GRCh38)
Location 17:40730976-40730998
Sequence CTTTTGTTTTTAATGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147477901_1147477902 2 Left 1147477901 17:40730951-40730973 CCTTCTTTTGGATGATTGAGAAC No data
Right 1147477902 17:40730976-40730998 CTTTTGTTTTTAATGACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147477902 Original CRISPR CTTTTGTTTTTAATGACAAA TGG Intergenic
No off target data available for this crispr