ID: 1147479806

View in Genome Browser
Species Human (GRCh38)
Location 17:40749476-40749498
Sequence CTTGATATCAGCAATGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 213}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147479806_1147479811 5 Left 1147479806 17:40749476-40749498 CCTTCTCCATTGCTGATATCAAG 0: 1
1: 0
2: 2
3: 10
4: 213
Right 1147479811 17:40749504-40749526 AAGTGACATCACTAAGTGAGGGG 0: 1
1: 1
2: 1
3: 21
4: 186
1147479806_1147479812 10 Left 1147479806 17:40749476-40749498 CCTTCTCCATTGCTGATATCAAG 0: 1
1: 0
2: 2
3: 10
4: 213
Right 1147479812 17:40749509-40749531 ACATCACTAAGTGAGGGGTTAGG 0: 1
1: 0
2: 3
3: 11
4: 133
1147479806_1147479810 4 Left 1147479806 17:40749476-40749498 CCTTCTCCATTGCTGATATCAAG 0: 1
1: 0
2: 2
3: 10
4: 213
Right 1147479810 17:40749503-40749525 CAAGTGACATCACTAAGTGAGGG 0: 1
1: 1
2: 0
3: 13
4: 149
1147479806_1147479813 25 Left 1147479806 17:40749476-40749498 CCTTCTCCATTGCTGATATCAAG 0: 1
1: 0
2: 2
3: 10
4: 213
Right 1147479813 17:40749524-40749546 GGGTTAGGAAGAGAAGAGATAGG 0: 1
1: 0
2: 2
3: 58
4: 692
1147479806_1147479809 3 Left 1147479806 17:40749476-40749498 CCTTCTCCATTGCTGATATCAAG 0: 1
1: 0
2: 2
3: 10
4: 213
Right 1147479809 17:40749502-40749524 CCAAGTGACATCACTAAGTGAGG 0: 1
1: 1
2: 0
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147479806 Original CRISPR CTTGATATCAGCAATGGAGA AGG (reversed) Intronic
900017681 1:164420-164442 CTTGATATCAGGAGTCGAGGCGG + Intergenic
900047940 1:523016-523038 CTTGATATCAGGAGTCGAGGCGG + Intergenic
900070158 1:764880-764902 CTTGATATCAGGAGTCGAGGCGG + Intergenic
900712171 1:4121344-4121366 CTTGCTCTGAGCATTGGAGAGGG + Intergenic
906755360 1:48308837-48308859 CTTAAAAGCAGCAAGGGAGAAGG - Intronic
907199579 1:52714961-52714983 GTTGATGACAGCAATGAAGAGGG + Intergenic
908145884 1:61242682-61242704 TTTAATATCAGCAATGGACTAGG + Intronic
908423786 1:63985157-63985179 ATTGAGATCAGGAAAGGAGATGG - Intronic
910236926 1:85046549-85046571 CTTGTACTCAGCAATGAAGAAGG + Intronic
910599335 1:89013928-89013950 CTTGCTATTAGCAATAGAAAAGG - Intronic
917036956 1:170758585-170758607 CTTGAGAACAGCAAGGGGGAAGG + Intergenic
917109577 1:171532268-171532290 CTGGGTATCAGGCATGGAGAAGG - Intronic
917769233 1:178258647-178258669 TTTTATGTCAGCAATGTAGAAGG - Intronic
918938658 1:190960142-190960164 TTTGACATCAGAAAGGGAGAAGG - Intergenic
919282435 1:195508460-195508482 CCTGATATCAGCAAGTGGGAGGG - Intergenic
920994184 1:210971656-210971678 CCTGAAATCAGCGATGGAAAAGG + Intronic
1063402297 10:5758024-5758046 GTTGACATCAGAAATGGAGAAGG - Intronic
1066372492 10:34829326-34829348 CTTGACAGCAGCAAGGAAGATGG + Intergenic
1068262915 10:54606517-54606539 CTTGCTATCAGAAAGAGAGAAGG + Intronic
1068500289 10:57834928-57834950 CTTTAAATCAGAGATGGAGAAGG - Intergenic
1072632450 10:97155657-97155679 CTTGATCCCAGCAAGGTAGAGGG + Intronic
1073538498 10:104299158-104299180 CTGGATATCAGCCATGAAGTGGG + Exonic
1074344211 10:112666135-112666157 GATGATATCAATAATGGAGAAGG - Intronic
1075146310 10:119885762-119885784 CTTTAAATCAGAAAGGGAGAAGG - Intronic
1076974278 11:159612-159634 CTTGATATCAGGAGTCGAGGCGG + Intergenic
1078277507 11:9864263-9864285 CTTGATCTGAGCAATCTAGAAGG - Intronic
1079438407 11:20482389-20482411 CTTGAAATCAGCAATGTTGAAGG + Intronic
1079824846 11:25178086-25178108 CTTGTGACCAGGAATGGAGAGGG - Intergenic
1082860017 11:57846596-57846618 CTTCTTAGCAGAAATGGAGAAGG + Intergenic
1085735583 11:79036259-79036281 GTTTATATAAGCAAAGGAGAAGG - Intronic
1086163655 11:83751941-83751963 CATGAGATCAGCAAGGGAGTAGG + Intronic
1087315593 11:96598885-96598907 CATGATATCAGCAAGGGAGAGGG + Intergenic
1087453832 11:98357768-98357790 CAACATATCAGCAGTGGAGACGG - Intergenic
1087889043 11:103516133-103516155 CTTGAGATCAGCCTTGAAGATGG + Intergenic
1088340655 11:108762414-108762436 AGTGATATCAACAATGGAAAAGG - Intronic
1089758845 11:120708126-120708148 CTCCATATGAGCCATGGAGAAGG + Intronic
1090596916 11:128329992-128330014 TTTTATATCAACTATGGAGAGGG - Intergenic
1090758209 11:129813760-129813782 CTAGATATTAGCAGTGCAGAAGG - Intergenic
1091509505 12:1107717-1107739 CTGGATGGCAGCAATGGGGAGGG + Intronic
1092390332 12:8071613-8071635 CCTGATTTCTGCAATGGAGGGGG + Intergenic
1094319977 12:29173180-29173202 CTTTATATCAGAGAGGGAGAAGG + Intronic
1094755001 12:33457719-33457741 CTTGAAAGCAGCAAGAGAGAAGG + Intergenic
1098047883 12:66420740-66420762 CTTGATATCTGAAATGACGAGGG + Exonic
1098693041 12:73514201-73514223 CTTTCTACCAGCAATGTAGAAGG - Intergenic
1099036746 12:77597372-77597394 CTTGATATCCTCAGTGCAGATGG + Intergenic
1099853904 12:88140364-88140386 TATGCTATCAGCAATTGAGAAGG - Intronic
1100407368 12:94283349-94283371 CTTGAGAGGGGCAATGGAGAGGG + Intronic
1101204646 12:102474468-102474490 CTGGAGATCAGTAAGGGAGATGG - Intronic
1101388242 12:104276942-104276964 CTTGATATAAGAAATAAAGATGG + Intronic
1102710161 12:114918892-114918914 CTTGATATCAGCCCTGGGGTGGG + Intergenic
1103616443 12:122155833-122155855 CTTGATATCAGCAGCAGAAATGG - Intergenic
1103738691 12:123077293-123077315 CTTGTTATCAGGGGTGGAGAGGG + Intronic
1104253347 12:127117543-127117565 CTAAACATCACCAATGGAGAGGG - Intergenic
1105654210 13:22417809-22417831 ATTTCTATCAGCAATGAAGAGGG - Intergenic
1105670573 13:22610432-22610454 CTTGATTTCTGAAATGGGGATGG - Intergenic
1105826442 13:24127414-24127436 TTGGATTTCAGCAATGGGGAGGG - Intronic
1107516464 13:41134203-41134225 CTTGATATCACCTTTGTAGATGG + Intergenic
1108571162 13:51752770-51752792 CTCTAAATAAGCAATGGAGATGG + Intronic
1110063697 13:71073459-71073481 CTTTGTATCAGCAATGATGAGGG + Intergenic
1111270442 13:85875088-85875110 ATTGCTATCAGCAATGGATGAGG + Intergenic
1112774761 13:102832044-102832066 CTTGATGTCAGGAAAGCAGATGG - Intronic
1113184012 13:107665567-107665589 ATTGAGAGCAGAAATGGAGAGGG - Intronic
1114152401 14:20058387-20058409 CTCCATATCAGCAATAAAGATGG + Intergenic
1114895831 14:26990114-26990136 ATTGGTCTCAGCAATGGATATGG + Intergenic
1116522678 14:45869629-45869651 ATAGATCTCAGCAATGGAGAGGG - Intergenic
1116684902 14:48026709-48026731 CTTTGTATGAGCAATAGAGAAGG - Intergenic
1117672141 14:58119040-58119062 CTAGAGATAAGCAATGTAGAAGG + Intronic
1119834148 14:77732485-77732507 CTTCCGATCAGCAATGTAGAGGG + Exonic
1122639176 14:103147317-103147339 CTTTATATCACCAATGCAGGGGG + Intergenic
1123662788 15:22579430-22579452 GTTGCTATCAGAAATGGAGTTGG + Intergenic
1124261496 15:28196486-28196508 GTTGCTATCAGAAATGGAGTTGG - Exonic
1124316589 15:28673734-28673756 GTTGCTATCAGAAATGGAGTTGG + Intergenic
1125084213 15:35711718-35711740 CTTCATCTCTGGAATGGAGATGG + Intergenic
1126836146 15:52667626-52667648 CTTGAAATCAGCCATGGTAATGG - Intronic
1128815276 15:70603624-70603646 CTTGATAACTGCACTGGAAAAGG + Intergenic
1129111076 15:73337624-73337646 CGTGATCTCAGCAATGAACACGG + Intronic
1131985346 15:98038178-98038200 CCTGATCTCAACAATGAAGAAGG - Intergenic
1132414521 15:101610828-101610850 CATGACAGCAGGAATGGAGAGGG - Intergenic
1135391055 16:22093678-22093700 CTTGATAACAGCATTGAAGTAGG + Intronic
1135947173 16:26875382-26875404 AGTGATGTCAGCCATGGAGATGG - Intergenic
1137941843 16:52695704-52695726 CTGGATGCCAGCAATGGAGGAGG + Intergenic
1138616084 16:58168455-58168477 GTAGAAATCAACAATGGAGATGG + Intronic
1138943641 16:61820990-61821012 TATGATATCATCGATGGAGATGG - Exonic
1141447461 16:84070660-84070682 CTTGGTCACAGAAATGGAGATGG + Exonic
1142445982 16:90138037-90138059 CTTGATATCAGGAGTCGAGGCGG - Intergenic
1142461526 17:97426-97448 CTTGATATCAGGAGTCGAGGCGG + Intergenic
1146484474 17:33231853-33231875 ATTGAGATGAGCAATGGGGAGGG + Intronic
1146590328 17:34123148-34123170 CTTGTTATCACCCTTGGAGAGGG - Intronic
1147479806 17:40749476-40749498 CTTGATATCAGCAATGGAGAAGG - Intronic
1147495407 17:40910922-40910944 CTTGCTCTCAAAAATGGAGAGGG - Intergenic
1149047562 17:52265647-52265669 CCTGCTACCAGCAATGGAGGTGG + Intergenic
1151087003 17:71391841-71391863 CTGGATACCAGTAATGGACAGGG + Intergenic
1151286440 17:73115130-73115152 CATGAGAACAGCAAGGGAGAAGG - Intergenic
1155719269 18:28990793-28990815 CTGTATACCAGCAATGGACATGG - Intergenic
1156689765 18:39693498-39693520 TTTGCTACCAGCTATGGAGAAGG - Intergenic
1158723217 18:59944423-59944445 GTAGATATCACCAATGGACAAGG - Intergenic
1160651228 19:229793-229815 CTTGATATCAGGAGTCGAGGCGG + Intergenic
1165847064 19:38824949-38824971 CTTTAAATCAGAGATGGAGAAGG - Intronic
1167408242 19:49328543-49328565 CTGGGTAATAGCAATGGAGATGG + Intergenic
927078236 2:19601619-19601641 CTAGAAATCAGCAATGCAGCAGG + Intergenic
927804575 2:26134968-26134990 GTAGATATCAGCAGTGGAGGAGG + Exonic
928168512 2:28988339-28988361 CTTGATATTGGCAGTGAAGAGGG - Intronic
930233242 2:48863961-48863983 CTTGATAGCACCAAGGGATATGG + Intergenic
930505868 2:52282337-52282359 CTTGATTTCAGCCATAGAGCCGG + Intergenic
931806169 2:65807655-65807677 ATTGTTAGCAGCAATGGACAAGG + Intergenic
933917548 2:87011254-87011276 CTTGCTATTAGCAAGGCAGAAGG + Intronic
934005448 2:87758663-87758685 CTTGCTATTAGCAAGGCAGAAGG - Intronic
934984299 2:98873193-98873215 CTTGTTCCCAGCAGTGGAGAAGG - Intronic
935768407 2:106392755-106392777 CTTGCTATTAGCAAGGCAGAAGG - Intronic
935861188 2:107331721-107331743 CTTAATATCAGCCATGGCAAAGG + Intergenic
936068394 2:109349315-109349337 CTTGATAAAAGGAAGGGAGAAGG - Intronic
936339830 2:111621315-111621337 CTTGACATCAGCCATGGTGGAGG + Intergenic
937848953 2:126615680-126615702 CTTCATCTTTGCAATGGAGATGG + Intergenic
939457253 2:142453578-142453600 CCTGAGAACAGCAATGCAGAAGG + Intergenic
940329900 2:152463529-152463551 CTTGGTACCAGTAATGCAGAAGG - Intronic
942030555 2:171954903-171954925 CTTGATGACAGAAAAGGAGAAGG + Intronic
942921857 2:181383818-181383840 ATTGAGATCAGCAGTGGGGATGG - Intergenic
943538005 2:189176482-189176504 CATGGGATAAGCAATGGAGAAGG - Intronic
944006324 2:194912193-194912215 CTTCATAACAGCCATGGAAAGGG + Intergenic
946255465 2:218438606-218438628 CTGGATCTCAGCAGAGGAGATGG - Intronic
1169189287 20:3647399-3647421 CTTGATATGATCAAAAGAGATGG - Exonic
1177542617 21:22514939-22514961 CTTGATATCAACAATTTACATGG + Intergenic
1179775301 21:43658313-43658335 CTTGTTATCTGCAAAGCAGAAGG + Exonic
1185126475 22:49013882-49013904 CTTCACAGCAGCGATGGAGAAGG - Intergenic
951716784 3:25657396-25657418 GATGATAACAGCAAGGGAGAAGG - Intronic
952356015 3:32584764-32584786 CTTGATAACAGCAATGTTCAGGG - Intergenic
952973623 3:38674383-38674405 CTTAATCTCAGCCTTGGAGATGG - Intergenic
955724310 3:61916831-61916853 CTTGAGATCTGTAATGGAAATGG - Intronic
955780068 3:62475238-62475260 CTTGACATCAGCATTGTAAAAGG + Intronic
955921010 3:63955348-63955370 CTTTGAATCAGCAGTGGAGATGG + Intronic
956860199 3:73315646-73315668 CTTGAAATCAAGAATGCAGAAGG + Intergenic
957163215 3:76636889-76636911 ATTGATATCAGCCAGGGTGAGGG + Intronic
957782427 3:84836543-84836565 CTTGAAAGCAGGAATGGAGTAGG - Intergenic
958670956 3:97203291-97203313 TTGGATATTAGCAGTGGAGATGG + Intronic
958672928 3:97227957-97227979 GTTGATATCAGCGGTGGAGTGGG + Intronic
961140445 3:124551400-124551422 ATTGGTATCAGCAACGGAAAGGG - Intronic
962522976 3:136214010-136214032 CTTGATCTGAGCAAAGGAAAAGG - Intergenic
963897967 3:150706075-150706097 CTAGACACCAGGAATGGAGAAGG - Intergenic
965423542 3:168493099-168493121 CTTGATATCTACCATGAAGAAGG + Intergenic
965927341 3:173998022-173998044 CTTGAGATTAGCCAAGGAGATGG + Intronic
966881280 3:184352669-184352691 CGTGGTCTCAGCATTGGAGAGGG + Intronic
967479414 3:189956782-189956804 CTGGATAGCAGCAATGAGGAGGG + Exonic
968228268 3:196989472-196989494 CTTCATATTAGCACTGGTGAGGG + Intronic
968366604 3:198190187-198190209 CTTGATATCAGGAGTCGAGGCGG - Intergenic
970507442 4:16745668-16745690 CTTCATAGCAGCAATGTCGAAGG + Intronic
971680013 4:29686437-29686459 GTTAATATCAGTAATTGAGATGG + Intergenic
971735598 4:30446055-30446077 ATTGCTGTCAGGAATGGAGAAGG + Intergenic
971790424 4:31163323-31163345 CTGTATATCAGAAATGGAGAAGG + Intergenic
972993186 4:44847547-44847569 CTTATTATCAGAAATGGAAATGG + Intergenic
976077441 4:81315754-81315776 CTTGATGTCAGAAAGGGGGAAGG + Intergenic
976128598 4:81859535-81859557 CTTGGTACCAGAAAGGGAGATGG - Intronic
976750155 4:88445111-88445133 CTGTATATCAGTTATGGAGAAGG - Intergenic
976904582 4:90220890-90220912 CTTTATTTCAAAAATGGAGAAGG - Intronic
977500354 4:97829204-97829226 CTGGGTATCACCAATGGAGATGG - Intronic
978829834 4:113070951-113070973 CTTGATGACAGTAATGGTGATGG + Intronic
980703319 4:136458995-136459017 CTTAATATCAAAACTGGAGAGGG - Intergenic
982201475 4:152965701-152965723 CTTGACATCAGCCATGGTTACGG - Intronic
982695954 4:158600882-158600904 TTTGATACAAGCAGTGGAGAAGG - Intronic
983699468 4:170574013-170574035 CTTGATCTGAACAATGGTGAGGG + Intergenic
986103624 5:4638055-4638077 CTTGATTGCAGCAATGGGAAAGG - Intergenic
986115385 5:4768760-4768782 GTTGATCTCAGGACTGGAGAAGG - Intergenic
986988732 5:13527368-13527390 CTCCATATCAGAAATGGACAAGG + Intergenic
987050067 5:14141982-14142004 ATTGACATCAGCAATGGTGGGGG - Intergenic
987284085 5:16438751-16438773 CTATATAACAGCAATGGGGATGG - Intergenic
987518056 5:18940663-18940685 CTTGATATCAGAAATGAAATAGG + Intergenic
988357765 5:30199863-30199885 CTTTAAATCAGAAAGGGAGAAGG - Intergenic
988765861 5:34375879-34375901 AGTGATATCAGAAATGAAGAGGG + Intergenic
993891490 5:93480255-93480277 CTTGAAATCAGCAAGAGAGAAGG + Intergenic
993959247 5:94276757-94276779 TTTGATAGCAGGAATAGAGAGGG + Intronic
995089789 5:108160924-108160946 CTTGTTCTCAGCAAGGGAAATGG - Intronic
995641915 5:114266944-114266966 CTTAATATCAGTAATCCAGATGG - Intergenic
998904335 5:146888417-146888439 CATGGTAGCAGCAGTGGAGATGG - Intronic
999340943 5:150771331-150771353 ATTGATGTCAGAAATGGAAATGG - Intergenic
999595315 5:153197037-153197059 CATCATATGAGCAATGGAGAAGG + Intergenic
1000361573 5:160452498-160452520 CTTGCCTTAAGCAATGGAGATGG - Intergenic
1000437938 5:161236279-161236301 CTTGAGATCAGCAATTAGGAGGG - Intergenic
1000877187 5:166655391-166655413 CTTGATATCGGTATTGAAGATGG - Intergenic
1002725827 5:181295394-181295416 CTTGATATCAGGAGTCGAGGCGG - Intergenic
1003243996 6:4369064-4369086 CTTGAAATAAGCCATGGGGATGG - Intergenic
1003266138 6:4566247-4566269 CTTGAAATCAGCCATGGTGGCGG + Intergenic
1004396414 6:15249135-15249157 CTTTACATAAGCACTGGAGAGGG - Intronic
1004696312 6:18036707-18036729 CTTGAAATCAGCCATGGTGGTGG + Intergenic
1007776987 6:44229375-44229397 CTTTGTATCTGCAATGGAGGAGG - Exonic
1008537369 6:52516913-52516935 CTTGGAAGCACCAATGGAGATGG + Intronic
1010079269 6:71839564-71839586 CTAGATATGAGCATTAGAGAAGG - Intergenic
1011824225 6:91287429-91287451 CTGGACATAAGCAATGAAGAAGG + Intergenic
1014411723 6:121131626-121131648 CCTGATATAATCAGTGGAGAGGG - Exonic
1015639764 6:135318828-135318850 CTGGATTTCAGAAATGCAGAAGG + Intronic
1016533377 6:145083794-145083816 CTTGATATCATCAATACAAAAGG - Intergenic
1017006055 6:150028765-150028787 CCTGAAATCAGGAATGGAAATGG + Intergenic
1017252952 6:152301781-152301803 CCTGAAATCAGCCACGGAGAGGG + Intronic
1018129245 6:160712916-160712938 CTTGCTATTAGCAAGGCAGAAGG - Intronic
1021913490 7:25409079-25409101 CTTGATTTCAGCAAAGCTGATGG - Intergenic
1022850464 7:34256507-34256529 CTTTTTCTCAGCAATGCAGAGGG - Intergenic
1024145638 7:46513809-46513831 AATGATGTCAACAATGGAGATGG - Intergenic
1024772854 7:52744887-52744909 CTTGATCTCAGGGATGAAGATGG + Intergenic
1032104725 7:129017738-129017760 CTTGATACCAGAAGTGGATAAGG - Intronic
1032375918 7:131417591-131417613 CTTGATATCAGTAATAGAGATGG + Intronic
1036296278 8:7540767-7540789 CATGATACCATAAATGGAGAGGG + Intronic
1036326288 8:7780252-7780274 CATGATACCATAAATGGAGAGGG - Intronic
1037343269 8:17870593-17870615 CTTGCTATAAGTGATGGAGATGG - Intronic
1038597632 8:28903564-28903586 CTTGATCTCAGCAAAAGATATGG + Intronic
1038835587 8:31117690-31117712 CTAGATATCAGAAAAGGAGATGG - Intronic
1039414093 8:37378970-37378992 CTTGAGCTCAGCAGTGGGGAAGG - Intergenic
1039680725 8:39732652-39732674 CTTGATATCCAGAATGTAGAAGG + Intergenic
1040918209 8:52585804-52585826 CTTGTTAGCAGTACTGGAGAAGG + Intergenic
1042579565 8:70261834-70261856 CGTCATATAAGCAAGGGAGAGGG - Intronic
1048194092 8:132317837-132317859 AGTGATATCTGCAATGGAAAGGG + Intronic
1049274960 8:141715626-141715648 CTTGCTACCAGCCATGGAGAAGG + Intergenic
1050240412 9:3628670-3628692 CTTAAATTAAGCAATGGAGAAGG - Intergenic
1051329531 9:16009309-16009331 TTTGATATCAGGAATGCAGATGG - Intronic
1055018926 9:71648453-71648475 CTTGATTTTTGCAATGCAGATGG + Intergenic
1055190489 9:73515649-73515671 CTTGATTTCAGCAAAGCAAAAGG + Intergenic
1055645729 9:78359699-78359721 GTTGGTATCAGGAATGGAGCAGG - Intergenic
1058702957 9:107615750-107615772 CCTCATTTGAGCAATGGAGATGG - Intergenic
1059873944 9:118611414-118611436 CTTGCAATAAGCAATGGAAAAGG - Intergenic
1060012204 9:120053633-120053655 CATGATACAAGCAATGGAGGTGG - Intergenic
1060273524 9:122165136-122165158 CTTGTTAGGAGGAATGGAGAAGG + Intronic
1062412108 9:136430815-136430837 CTTGAAAACACCCATGGAGAGGG + Intronic
1062750963 9:138253038-138253060 CTTGATATCAGGAGTCGAGGCGG - Intergenic
1187024360 X:15418574-15418596 GTTGATATCAGGAATTGAGCTGG - Intronic
1194739983 X:97560940-97560962 CTTCATATCATGAATGTAGATGG + Intronic
1196567741 X:117228912-117228934 CTTTATATCTGCAATAGAGGAGG + Intergenic
1198077478 X:133207751-133207773 CCTGAAATAAGCAATAGAGAGGG - Intergenic
1201312107 Y:12606479-12606501 CTTTAAATCAGAGATGGAGAAGG + Intergenic
1201413331 Y:13722796-13722818 CTGGGTATCAGCAGTGGTGATGG - Intergenic