ID: 1147480001

View in Genome Browser
Species Human (GRCh38)
Location 17:40751470-40751492
Sequence GAGAATTAGGTCAACGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147480001_1147480007 24 Left 1147480001 17:40751470-40751492 CCTGTCCCGTTGACCTAATTCTC 0: 1
1: 0
2: 1
3: 4
4: 59
Right 1147480007 17:40751517-40751539 TGAAGTAGCCTGTTTCATTCTGG 0: 1
1: 0
2: 1
3: 9
4: 135
1147480001_1147480008 25 Left 1147480001 17:40751470-40751492 CCTGTCCCGTTGACCTAATTCTC 0: 1
1: 0
2: 1
3: 4
4: 59
Right 1147480008 17:40751518-40751540 GAAGTAGCCTGTTTCATTCTGGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147480001 Original CRISPR GAGAATTAGGTCAACGGGAC AGG (reversed) Intronic
900726341 1:4218762-4218784 GAAAATTAAGTCATCGGGCCTGG - Intergenic
901904930 1:12400244-12400266 GAGAATGAGGTCATCGAGACCGG + Exonic
908343115 1:63203322-63203344 GAGAATAATGTCAATGGAACTGG - Intergenic
909139348 1:71844087-71844109 TAAAATTAGGTTAAGGGGACAGG + Intronic
916265136 1:162882982-162883004 GAAAATGAGGTCAACAGGACAGG - Intergenic
916758172 1:167792871-167792893 TAGAATTATGTCAAAGGGGCTGG - Intergenic
917267746 1:173239732-173239754 GAGAATTGGCTCAGTGGGACCGG + Intergenic
922919967 1:229293878-229293900 GAGAATGGGGCCAAAGGGACAGG + Intronic
1069418048 10:68219357-68219379 TAGAATTTGTTCAACTGGACTGG - Intergenic
1069606433 10:69741713-69741735 GAGAATTAAGCCAAAGGGCCAGG + Intergenic
1071158217 10:82715973-82715995 GGCAATTAGGTCACCAGGACAGG - Intronic
1073775455 10:106780634-106780656 GAGGATTTGCTCAAGGGGACTGG - Intronic
1077452478 11:2657063-2657085 GACAAATAGGCCAATGGGACAGG - Intronic
1080521166 11:33068827-33068849 GCGAATGGGGTCATCGGGACTGG - Exonic
1083834584 11:65257461-65257483 GAGAATTTGGTCAAAGTGACTGG + Intergenic
1087060373 11:93971329-93971351 GAGAAATAGTGCAGCGGGACGGG - Intergenic
1092570605 12:9717112-9717134 GAAAATTAGTTCAACAAGACTGG + Intronic
1096805231 12:54136672-54136694 GAGGATTTGGTCAACTGGGCAGG - Intergenic
1098885744 12:75959117-75959139 GAATATTAGGTCATCGGGCCTGG + Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1109776293 13:67045078-67045100 GAGAATTAGGGGGACAGGACAGG + Intronic
1112796919 13:103067221-103067243 GAGAATTAGGTCAAAGTGACAGG + Intergenic
1129279741 15:74474981-74475003 GAGAATTAGGTCCACTGAAGTGG + Intergenic
1130563856 15:84979064-84979086 GAGCATGAGGTCAATGGGGCTGG - Intergenic
1134073002 16:11272259-11272281 GAGAATTAGCTCAAGGTGGCTGG + Intronic
1136123982 16:28163057-28163079 GAAATTTAGGTTAACGCGACTGG - Intronic
1138400821 16:56742126-56742148 GTGCATTAGGTCAATGGGACAGG + Intronic
1139057529 16:63203733-63203755 GAGAATCACTTCAACGGGAGTGG - Intergenic
1139534283 16:67562197-67562219 GGGAATAAGGTCAAGCGGACTGG + Intergenic
1139872463 16:70118510-70118532 GACAGTGAGGTCAATGGGACGGG + Intronic
1141557430 16:84845394-84845416 GAGACTGGGGTCATCGGGACAGG + Intronic
1143515942 17:7419225-7419247 GAGAATGAGGTCAGCGGTGCTGG + Exonic
1147480001 17:40751470-40751492 GAGAATTAGGTCAACGGGACAGG - Intronic
1161128171 19:2571944-2571966 GACAAATAGGCCAATGGGACAGG - Intronic
1161576951 19:5059561-5059583 GAGACTTAGGTCATAGGAACAGG + Intronic
1164615481 19:29664892-29664914 GAGAATTAGCCCACCAGGACCGG - Intergenic
936090150 2:109496572-109496594 GAGAAGCAGGTCAAAGGGGCAGG - Intronic
936495608 2:113018132-113018154 GAGAGTTATGTCAAAGGGAAAGG + Intergenic
936598273 2:113870224-113870246 GTGAACTTGGTCAAAGGGACTGG - Intergenic
944392718 2:199234562-199234584 GACAAATAGATCAACGGAACAGG - Intergenic
1169189751 20:3650754-3650776 CAGAATTAGTTCAACGAAACAGG - Exonic
1169705850 20:8503963-8503985 GAGAAATAGGACAAGGGGAAGGG - Intronic
1174434145 20:50493386-50493408 GAGAATTAGGTAAAAGGGCAAGG + Intergenic
1184461087 22:44638524-44638546 TAGAATTAGGTTTACGGGCCGGG - Intergenic
950507531 3:13404584-13404606 GAGGCTTAGGAAAACGGGACTGG + Intronic
951047916 3:18062221-18062243 GAGAATTATGTAATCTGGACTGG + Intronic
952877324 3:37957367-37957389 GAGAATTAGGTTAATGGAGCTGG - Intronic
955429506 3:58828013-58828035 GATAATCAGGTCCACGGTACAGG + Intronic
961500985 3:127335805-127335827 GAGATATTGGTCAAAGGGACAGG + Intergenic
962996758 3:140636499-140636521 GGGAATGAGGCCAACAGGACTGG + Intergenic
963711743 3:148754791-148754813 GAGAATAAAGGAAACGGGACTGG + Intergenic
977080483 4:92520865-92520887 GAGGATAAGGTCATAGGGACAGG + Intronic
977248402 4:94660861-94660883 GAAAATTAGGTCAACCAGCCTGG + Intronic
989076510 5:37569114-37569136 GAGAATTATGTCAACCTGTCAGG + Intronic
991127842 5:63087852-63087874 CAGAATGAGGTCAAAGGCACTGG - Intergenic
1023150319 7:37195794-37195816 GAGCATTAGGGCAAAGGGAAAGG - Intronic
1024526290 7:50352568-50352590 AAGAATAATGTCAATGGGACGGG + Intronic
1035865895 8:3081159-3081181 GAGAATGAGCTCAACGTGCCAGG + Intronic
1036917704 8:12820609-12820631 GAGAATTTGGTAAATGGGAAGGG + Intergenic
1037090965 8:14918196-14918218 GAGAATTAAGGCAATGAGACCGG + Intronic
1050596950 9:7213592-7213614 GAGCATTGGCTCAAGGGGACAGG - Intergenic
1058198501 9:102008828-102008850 CAGAATTAGGACCACAGGACTGG - Intergenic
1194740896 X:97573224-97573246 GTGAATTTGCTCAATGGGACTGG - Intronic
1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG + Intronic
1199093021 X:143713262-143713284 GAGAATAAGGAGAATGGGACTGG - Intronic