ID: 1147484628

View in Genome Browser
Species Human (GRCh38)
Location 17:40800777-40800799
Sequence CAGTGGGGATGCAGAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147484624_1147484628 -3 Left 1147484624 17:40800757-40800779 CCAGGTGAGAAGGATGAAGGCAG No data
Right 1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147484628 Original CRISPR CAGTGGGGATGCAGAGAAGA TGG Intergenic
No off target data available for this crispr