ID: 1147485344

View in Genome Browser
Species Human (GRCh38)
Location 17:40807221-40807243
Sequence AAATCTTGTCAGCATGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147485344_1147485351 25 Left 1147485344 17:40807221-40807243 CCAGGGACATGCTGACAAGATTT No data
Right 1147485351 17:40807269-40807291 AGGGTACAGTGGCACAATCTCGG No data
1147485344_1147485345 0 Left 1147485344 17:40807221-40807243 CCAGGGACATGCTGACAAGATTT No data
Right 1147485345 17:40807244-40807266 TTTCCTACGCTCTGTCGTCCAGG No data
1147485344_1147485348 6 Left 1147485344 17:40807221-40807243 CCAGGGACATGCTGACAAGATTT No data
Right 1147485348 17:40807250-40807272 ACGCTCTGTCGTCCAGGCTAGGG No data
1147485344_1147485349 14 Left 1147485344 17:40807221-40807243 CCAGGGACATGCTGACAAGATTT No data
Right 1147485349 17:40807258-40807280 TCGTCCAGGCTAGGGTACAGTGG No data
1147485344_1147485347 5 Left 1147485344 17:40807221-40807243 CCAGGGACATGCTGACAAGATTT No data
Right 1147485347 17:40807249-40807271 TACGCTCTGTCGTCCAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147485344 Original CRISPR AAATCTTGTCAGCATGTCCC TGG (reversed) Intergenic