ID: 1147486438

View in Genome Browser
Species Human (GRCh38)
Location 17:40819156-40819178
Sequence GACCTCACCCCGTTTAGTTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 26}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147486438_1147486443 12 Left 1147486438 17:40819156-40819178 CCGGAACTAAACGGGGTGAGGTC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1147486443 17:40819191-40819213 CTCTAACGTTGGAAAACGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 40
1147486438_1147486442 11 Left 1147486438 17:40819156-40819178 CCGGAACTAAACGGGGTGAGGTC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1147486442 17:40819190-40819212 TCTCTAACGTTGGAAAACGGTGG 0: 1
1: 0
2: 0
3: 4
4: 41
1147486438_1147486441 8 Left 1147486438 17:40819156-40819178 CCGGAACTAAACGGGGTGAGGTC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1147486441 17:40819187-40819209 TTATCTCTAACGTTGGAAAACGG 0: 1
1: 0
2: 0
3: 15
4: 415
1147486438_1147486440 1 Left 1147486438 17:40819156-40819178 CCGGAACTAAACGGGGTGAGGTC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1147486440 17:40819180-40819202 CATTCGGTTATCTCTAACGTTGG 0: 1
1: 0
2: 1
3: 4
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147486438 Original CRISPR GACCTCACCCCGTTTAGTTC CGG (reversed) Exonic
920862926 1:209725607-209725629 GACCTCTCCCCATTTCTTTCAGG + Intronic
924743811 1:246814083-246814105 GACCTCACTCCCTTTACTACCGG - Intergenic
1063034539 10:2272455-2272477 GACCTCACACCGTTTTCTTCTGG - Intergenic
1063559279 10:7111514-7111536 GACCTCACCCCCTGTTCTTCTGG + Intergenic
1068265434 10:54642413-54642435 GATCTCACCTCGCTTACTTCTGG + Intronic
1080576316 11:33602974-33602996 CACCTTACCCCGTTCAGTTTGGG + Intronic
1081825926 11:46051693-46051715 GTCCTCACCCCCTTGAGTTGAGG - Intronic
1095835979 12:46638765-46638787 TGCCTCTCCCCCTTTAGTTCTGG - Intergenic
1118663456 14:68040714-68040736 GACCTTACCCAGGTAAGTTCTGG - Intronic
1127935754 15:63636066-63636088 GACCTCACCACTTTCAGTTAGGG + Exonic
1147486438 17:40819156-40819178 GACCTCACCCCGTTTAGTTCCGG - Exonic
1158962376 18:62597240-62597262 GATCTCTCCCCTCTTAGTTCAGG - Intergenic
1160861593 19:1239530-1239552 AGCCTCCCCCCGTTTAGTACAGG - Intergenic
1162786299 19:13037018-13037040 GACCTCACCCTGTTCAGCCCAGG - Intronic
1166143491 19:40818767-40818789 GACCTGACCCCGCTCAGCTCAGG - Intronic
1168689628 19:58368844-58368866 GACCTCACACAGTTGAGTCCGGG + Exonic
966599186 3:181758390-181758412 GACCTAACCTGGGTTAGTTCAGG + Intergenic
970178049 4:13359111-13359133 GACCTCATCCTGTTTGGTTTGGG - Intergenic
970693820 4:18651419-18651441 GCCCTCACCCCTTTCAGTTGTGG - Intergenic
972006711 4:34118667-34118689 GACCTCACCATTTTTAGATCTGG - Intergenic
975437019 4:74365076-74365098 GACCTCACCCCGTTAGGGCCCGG + Intergenic
982068959 4:151678566-151678588 GACCTCACCGCGTTTAGGAAAGG - Intronic
1000066400 5:157696289-157696311 AACCTCACCCAGTTTTTTTCAGG - Intergenic
1004513507 6:16302395-16302417 TAACTCACCCAGTTTAGTTTGGG - Exonic
1004825270 6:19413094-19413116 CACATCACCCTGTTTAATTCTGG - Intergenic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1024149531 7:46556572-46556594 GAACTGACCCCATTTAGTTACGG - Intergenic
1062290804 9:135793557-135793579 CACCTCACCACGTTCACTTCAGG + Intergenic