ID: 1147486440

View in Genome Browser
Species Human (GRCh38)
Location 17:40819180-40819202
Sequence CATTCGGTTATCTCTAACGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 33}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147486431_1147486440 10 Left 1147486431 17:40819147-40819169 CCGCCGCCTCCGGAACTAAACGG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1147486440 17:40819180-40819202 CATTCGGTTATCTCTAACGTTGG 0: 1
1: 0
2: 1
3: 4
4: 33
1147486435_1147486440 7 Left 1147486435 17:40819150-40819172 CCGCCTCCGGAACTAAACGGGGT 0: 1
1: 0
2: 0
3: 2
4: 13
Right 1147486440 17:40819180-40819202 CATTCGGTTATCTCTAACGTTGG 0: 1
1: 0
2: 1
3: 4
4: 33
1147486429_1147486440 19 Left 1147486429 17:40819138-40819160 CCGCCGCGTCCGCCGCCTCCGGA 0: 1
1: 1
2: 1
3: 52
4: 577
Right 1147486440 17:40819180-40819202 CATTCGGTTATCTCTAACGTTGG 0: 1
1: 0
2: 1
3: 4
4: 33
1147486436_1147486440 4 Left 1147486436 17:40819153-40819175 CCTCCGGAACTAAACGGGGTGAG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1147486440 17:40819180-40819202 CATTCGGTTATCTCTAACGTTGG 0: 1
1: 0
2: 1
3: 4
4: 33
1147486430_1147486440 16 Left 1147486430 17:40819141-40819163 CCGCGTCCGCCGCCTCCGGAACT 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1147486440 17:40819180-40819202 CATTCGGTTATCTCTAACGTTGG 0: 1
1: 0
2: 1
3: 4
4: 33
1147486438_1147486440 1 Left 1147486438 17:40819156-40819178 CCGGAACTAAACGGGGTGAGGTC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1147486440 17:40819180-40819202 CATTCGGTTATCTCTAACGTTGG 0: 1
1: 0
2: 1
3: 4
4: 33
1147486427_1147486440 22 Left 1147486427 17:40819135-40819157 CCGCCGCCGCGTCCGCCGCCTCC 0: 1
1: 5
2: 117
3: 1746
4: 3641
Right 1147486440 17:40819180-40819202 CATTCGGTTATCTCTAACGTTGG 0: 1
1: 0
2: 1
3: 4
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147486440 Original CRISPR CATTCGGTTATCTCTAACGT TGG Exonic
917577536 1:176339767-176339789 CATGCTATTATCTCTAAAGTTGG + Intergenic
924354321 1:243153854-243153876 CATTTGGTTATCTGTAAAGCTGG + Intronic
1064132560 10:12722916-12722938 CATTAGTATATCTCTAACGGAGG + Intronic
1071998137 10:91166772-91166794 CATTCTGTCATCTCTAAAGTGGG + Intronic
1076494565 10:130888450-130888472 CATGAGGTTAGCTCTAACGAGGG + Intergenic
1080510888 11:32970105-32970127 CATTTGGTTATATCTACCTTAGG + Intronic
1096405803 12:51343489-51343511 CATTCTCCTATCTCTAAAGTGGG - Intronic
1114081942 14:19208894-19208916 CATTGTGTTATCCCCAACGTTGG + Intergenic
1116835684 14:49767670-49767692 CAGTCGCTTAGCTCTCACGTGGG - Exonic
1117335220 14:54751655-54751677 CATTCCGTTTTCTCTGACTTTGG - Intronic
1124889245 15:33716722-33716744 CACTCAGTTATCACTATCGTTGG - Intronic
1129307211 15:74674458-74674480 CATTAGGTTATTTGTAACCTTGG + Intronic
1132107017 15:99070443-99070465 CAGTCTCTTATCTGTAACGTAGG - Intergenic
1133849366 16:9487698-9487720 CATTCGTTTATCTGTGAAGTGGG - Intergenic
1147486440 17:40819180-40819202 CATTCGGTTATCTCTAACGTTGG + Exonic
926336640 2:11867799-11867821 CATTCTGTTATCTATAATGTGGG - Intergenic
932949196 2:76272714-76272736 CATTTTGATATCTCTAAAGTTGG + Intergenic
939122596 2:138136070-138136092 CATTCTGTTATCTCTCACGTTGG + Intergenic
939362757 2:141195159-141195181 CATTCGGTTCTCTCTCTCTTTGG + Intronic
946825951 2:223678107-223678129 CATTCCTTTATCTGTAAAGTGGG - Intergenic
1173879257 20:46399023-46399045 CATTTTCTTATCTCTAAGGTGGG - Intronic
1182481053 22:30608970-30608992 CATTCCTTTATCTGTAAAGTGGG + Intronic
965578616 3:170244238-170244260 CATGTGGTTATCTCTAAGGTGGG + Intronic
974183099 4:58408959-58408981 CATTCAGTTACATCTAACCTTGG - Intergenic
974226726 4:59055456-59055478 CATTTGGTTATATCTAAGCTGGG - Intergenic
977801296 4:101236103-101236125 CATTTGGTTATTTGTTACGTAGG - Intronic
979917590 4:126455717-126455739 GATTAGGTTATCTCGAACCTAGG + Intergenic
995745920 5:115403169-115403191 CATTCCGTTATCTTTTATGTGGG + Intergenic
1000112666 5:158123822-158123844 CATTCTGTAATCTCTAACCGTGG + Intergenic
1011137946 6:84119607-84119629 CAGTTGGTTATCCCTAATGTTGG - Intergenic
1014516878 6:122389917-122389939 CATTCTGTTAGCTCAAACGTGGG + Intergenic
1016489968 6:144588834-144588856 CATTCTTTTATCTCTATGGTAGG - Intronic
1041083193 8:54233082-54233104 CATTGGGTTGTCTCTAGCTTGGG - Intergenic
1050318858 9:4430653-4430675 CATTCTGTTATCCCTAAGGAAGG + Intergenic
1188464530 X:30464746-30464768 CATTTTGTTGTCTCTAAAGTAGG + Intergenic
1189699473 X:43702321-43702343 CTTTCTCTTATCTCTAAAGTAGG - Intronic
1194177057 X:90663994-90664016 CAATCAGTTATCTCTAAAGAAGG - Intergenic
1198885060 X:141326771-141326793 CAATCAGTTGTCTCTAACATTGG + Intergenic
1200523675 Y:4244849-4244871 CAATCAGTTATCTCTAAAGAAGG - Intergenic