ID: 1147486441

View in Genome Browser
Species Human (GRCh38)
Location 17:40819187-40819209
Sequence TTATCTCTAACGTTGGAAAA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 415}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147486435_1147486441 14 Left 1147486435 17:40819150-40819172 CCGCCTCCGGAACTAAACGGGGT 0: 1
1: 0
2: 0
3: 2
4: 13
Right 1147486441 17:40819187-40819209 TTATCTCTAACGTTGGAAAACGG 0: 1
1: 0
2: 0
3: 15
4: 415
1147486438_1147486441 8 Left 1147486438 17:40819156-40819178 CCGGAACTAAACGGGGTGAGGTC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1147486441 17:40819187-40819209 TTATCTCTAACGTTGGAAAACGG 0: 1
1: 0
2: 0
3: 15
4: 415
1147486430_1147486441 23 Left 1147486430 17:40819141-40819163 CCGCGTCCGCCGCCTCCGGAACT 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1147486441 17:40819187-40819209 TTATCTCTAACGTTGGAAAACGG 0: 1
1: 0
2: 0
3: 15
4: 415
1147486431_1147486441 17 Left 1147486431 17:40819147-40819169 CCGCCGCCTCCGGAACTAAACGG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1147486441 17:40819187-40819209 TTATCTCTAACGTTGGAAAACGG 0: 1
1: 0
2: 0
3: 15
4: 415
1147486427_1147486441 29 Left 1147486427 17:40819135-40819157 CCGCCGCCGCGTCCGCCGCCTCC 0: 1
1: 5
2: 117
3: 1746
4: 3641
Right 1147486441 17:40819187-40819209 TTATCTCTAACGTTGGAAAACGG 0: 1
1: 0
2: 0
3: 15
4: 415
1147486429_1147486441 26 Left 1147486429 17:40819138-40819160 CCGCCGCGTCCGCCGCCTCCGGA 0: 1
1: 1
2: 1
3: 52
4: 577
Right 1147486441 17:40819187-40819209 TTATCTCTAACGTTGGAAAACGG 0: 1
1: 0
2: 0
3: 15
4: 415
1147486436_1147486441 11 Left 1147486436 17:40819153-40819175 CCTCCGGAACTAAACGGGGTGAG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1147486441 17:40819187-40819209 TTATCTCTAACGTTGGAAAACGG 0: 1
1: 0
2: 0
3: 15
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147486441 Original CRISPR TTATCTCTAACGTTGGAAAA CGG Exonic
908996020 1:70155434-70155456 TTATGTTTAAACTTGGAAAATGG - Intronic
909588470 1:77318399-77318421 TAATCTCCAATGTTGGAGAAGGG - Intronic
909674398 1:78223299-78223321 TTATTTCTCACTTGGGAAAAAGG + Intergenic
915551164 1:156635336-156635358 TCATCTCTCAGGTGGGAAAACGG - Intergenic
917328700 1:173860132-173860154 TCATATATAAAGTTGGAAAAGGG + Intergenic
918389374 1:184042049-184042071 TTATGTCTTATGATGGAAAAAGG + Intergenic
919370436 1:196717910-196717932 TGAGCAGTAACGTTGGAAAATGG + Intronic
921621583 1:217331379-217331401 TAATCTCTAATGTTGGAGGAGGG - Intergenic
924577696 1:245295173-245295195 TTATATCGAATGTTTGAAAAGGG - Intronic
1064077532 10:12281410-12281432 TTATCTCTACTTTTGGAATACGG + Intergenic
1069435459 10:68378003-68378025 TTTTCTCTAAGGTTACAAAAAGG + Intronic
1069471330 10:68692675-68692697 TTATCTCTAAAATTGGAATTAGG + Exonic
1071405004 10:85321152-85321174 TTATCCTTAACCATGGAAAAAGG + Intergenic
1074057363 10:109934697-109934719 TCATCTGTAAAGTGGGAAAAAGG + Intergenic
1074504739 10:114059455-114059477 TTATCTTAAAAGTTGGAAAGAGG + Intergenic
1074991136 10:118709202-118709224 TTATCTCCAACAGTGGGAAAAGG + Intronic
1080173857 11:29338734-29338756 TAATCTCTAATGTTGGAGGAGGG - Intergenic
1080590440 11:33718919-33718941 TTATCTCTGATGATGGAAAAGGG - Intronic
1081404675 11:42683324-42683346 TGATCTCTAACGCTGGAGATGGG + Intergenic
1085429483 11:76435146-76435168 TTATGTCTAACATTTGAAAATGG + Intergenic
1086102692 11:83117628-83117650 TTATCTATAGTGTTGCAAAATGG + Intergenic
1087759815 11:102093556-102093578 TTATCTAGAAAGTTGTAAAATGG - Intergenic
1091163695 11:133451062-133451084 ATGTCTCTAACGGGGGAAAAGGG + Intronic
1092032977 12:5305321-5305343 ATATCTCCAACATTGGGAAATGG + Intergenic
1094295726 12:28902155-28902177 TAATCCCTAATGTTGGGAAAGGG + Intergenic
1095616542 12:44196922-44196944 TTGTTTCTAACGTTAGGAAATGG - Intronic
1095847697 12:46763527-46763549 TAATCTCTAATGTTGGAAGTGGG - Intergenic
1096427549 12:51516937-51516959 TCATCTCTAAGATGGGAAAAGGG + Intergenic
1098226240 12:68328040-68328062 TCTTCTCTAAAGTGGGAAAAAGG - Intronic
1104496037 12:129240058-129240080 TTATCCCTAATGCTAGAAAATGG - Intronic
1105160126 13:17419122-17419144 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105160245 13:17420992-17421014 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105160365 13:17422860-17422882 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105160516 13:17425237-17425259 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105160639 13:17427106-17427128 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105160758 13:17428977-17428999 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105160832 13:17430167-17430189 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105161013 13:17433054-17433076 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105161131 13:17434923-17434945 TTAACAATATCGTTGGAAAAGGG + Intergenic
1105161293 13:17437300-17437322 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105161409 13:17439170-17439192 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105161528 13:17441041-17441063 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105161605 13:17442232-17442254 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105161680 13:17443413-17443435 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105161980 13:17448335-17448357 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105162323 13:17453770-17453792 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105162437 13:17455633-17455655 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105162511 13:17456822-17456844 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105162613 13:17458523-17458545 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105162850 13:17462260-17462282 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105163042 13:17465315-17465337 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105163347 13:17470078-17470100 TTAACGATATCGTTGGAAAACGG + Intergenic
1105163449 13:17471770-17471792 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105163570 13:17473635-17473657 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105163812 13:17477373-17477395 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105163930 13:17479243-17479265 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105164238 13:17484001-17484023 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105164359 13:17485873-17485895 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105164469 13:17487737-17487759 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105164544 13:17488927-17488949 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105164620 13:17490119-17490141 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105165161 13:17498619-17498641 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105165283 13:17500492-17500514 TTAACTATATCGTTGGAAAAGGG + Intergenic
1105165335 13:17501343-17501365 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105165500 13:17503895-17503917 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105165575 13:17505087-17505109 TTAACGATATCGTTGGAAAACGG + Intergenic
1105165649 13:17506271-17506293 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105165841 13:17509331-17509353 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105165962 13:17511206-17511228 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105166156 13:17514267-17514289 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105166267 13:17516140-17516162 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105166454 13:17519030-17519052 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105166524 13:17520051-17520073 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105166597 13:17521240-17521262 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105166969 13:17527020-17527042 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105167072 13:17528718-17528740 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105167193 13:17530589-17530611 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105167307 13:17532461-17532483 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105167426 13:17534331-17534353 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105167662 13:17538070-17538092 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105167828 13:17540623-17540645 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105168038 13:17543853-17543875 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105168113 13:17545043-17545065 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105168190 13:17546233-17546255 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105168254 13:17547252-17547274 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105168326 13:17548442-17548464 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105168440 13:17550315-17550337 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105168554 13:17552184-17552206 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105168675 13:17554053-17554075 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105168795 13:17555925-17555947 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105168915 13:17557794-17557816 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105168994 13:17558985-17559007 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105169096 13:17560682-17560704 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105169217 13:17562553-17562575 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105169404 13:17565447-17565469 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105169481 13:17566636-17566658 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105169722 13:17570371-17570393 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105169838 13:17572240-17572262 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105169994 13:17574792-17574814 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105170112 13:17576663-17576685 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105170231 13:17578532-17578554 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105170352 13:17580403-17580425 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105170467 13:17582269-17582291 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105170707 13:17586011-17586033 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105170820 13:17587709-17587731 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105171012 13:17590771-17590793 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105171380 13:17596377-17596399 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105171543 13:17598922-17598944 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105171772 13:17602486-17602508 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105171941 13:17605027-17605049 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105172059 13:17606898-17606920 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105172183 13:17608769-17608791 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105172302 13:17610640-17610662 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105172367 13:17611651-17611673 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105172612 13:17615389-17615411 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105172734 13:17617258-17617280 TTAACAATATCGTTGGAAAAGGG + Intergenic
1105172856 13:17619128-17619150 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105173077 13:17622523-17622545 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105173193 13:17624394-17624416 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105173507 13:17629153-17629175 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105173628 13:17631024-17631046 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105173703 13:17632214-17632236 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105173927 13:17635788-17635810 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105174040 13:17637487-17637509 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105174111 13:17638679-17638701 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105174283 13:17641401-17641423 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105174730 13:17648202-17648224 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105174848 13:17650072-17650094 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105175074 13:17653642-17653664 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105175113 13:17654320-17654342 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105175472 13:17659928-17659950 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105175592 13:17661800-17661822 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105175670 13:17662990-17663012 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105175788 13:17664861-17664883 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105175911 13:17666732-17666754 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105176132 13:17670299-17670321 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105176256 13:17672168-17672190 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105176375 13:17674039-17674061 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105176621 13:17677782-17677804 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105176743 13:17679652-17679674 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105176898 13:17682033-17682055 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105177020 13:17683903-17683925 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105177138 13:17685773-17685795 TTAACAATATCGTTGGAAAAGGG + Intergenic
1105177258 13:17687644-17687666 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105177377 13:17689518-17689540 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105177499 13:17691387-17691409 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105177616 13:17693259-17693281 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105177682 13:17694280-17694302 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105177793 13:17695983-17696005 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105178023 13:17699551-17699573 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105178136 13:17701252-17701274 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105178503 13:17706868-17706890 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105178675 13:17709421-17709443 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105178862 13:17712312-17712334 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105178903 13:17712994-17713016 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105179269 13:17718596-17718618 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105179433 13:17721149-17721171 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105179553 13:17723020-17723042 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105179667 13:17724719-17724741 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105179907 13:17728459-17728481 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105180411 13:17736272-17736294 TTAGCGATATCGTTGGAAAAGGG + Intergenic
1105180528 13:17738146-17738168 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105180648 13:17740016-17740038 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105180883 13:17743752-17743774 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105180959 13:17744933-17744955 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105181022 13:17745949-17745971 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105181467 13:17753088-17753110 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105181706 13:17756658-17756680 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105181922 13:17760057-17760079 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105182154 13:17763628-17763650 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105182492 13:17768886-17768908 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105182614 13:17770756-17770778 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105182731 13:17772625-17772647 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105182850 13:17774494-17774516 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105182955 13:17776193-17776215 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105183067 13:17778067-17778089 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105183187 13:17779937-17779959 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105183648 13:17787244-17787266 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105183767 13:17789105-17789127 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105183878 13:17790796-17790818 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105184003 13:17792666-17792688 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105184125 13:17794536-17794558 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105184236 13:17796233-17796255 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105184357 13:17798103-17798125 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105184459 13:17799631-17799653 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105184579 13:17801501-17801523 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105184797 13:17804899-17804921 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105185033 13:17808642-17808664 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105185272 13:17812383-17812405 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105185388 13:17814252-17814274 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105185511 13:17816123-17816145 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105185746 13:17819858-17819880 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105185948 13:17822918-17822940 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105185974 13:17823428-17823450 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105186078 13:17825124-17825146 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105186193 13:17826991-17827013 TTAACAATATCGTTGGAAAAGGG + Intergenic
1105186315 13:17828861-17828883 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105186676 13:17834475-17834497 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105186792 13:17836346-17836368 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105187016 13:17839742-17839764 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105187255 13:17843482-17843504 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105187616 13:17849094-17849116 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105187849 13:17852838-17852860 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105187976 13:17854711-17854733 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105188100 13:17856581-17856603 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105188222 13:17858451-17858473 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105188339 13:17860321-17860343 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105188465 13:17862188-17862210 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105188588 13:17864057-17864079 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105188824 13:17867795-17867817 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105189067 13:17871537-17871559 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105189185 13:17873407-17873429 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105189530 13:17878847-17878869 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105189650 13:17880714-17880736 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105189728 13:17881907-17881929 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105190130 13:17888203-17888225 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105190338 13:17891433-17891455 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105190585 13:17895174-17895196 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105190709 13:17897044-17897066 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105190836 13:17898917-17898939 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105190952 13:17900787-17900809 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105191074 13:17902658-17902680 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105191194 13:17904529-17904551 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105191314 13:17906399-17906421 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105191554 13:17910140-17910162 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105191678 13:17912009-17912031 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105191902 13:17915576-17915598 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105192024 13:17917446-17917468 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105192144 13:17919312-17919334 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105192264 13:17921175-17921197 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105192511 13:17924916-17924938 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105192628 13:17926785-17926807 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105192855 13:17930353-17930375 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105193206 13:17935625-17935647 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105193429 13:17939194-17939216 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105193672 13:17942941-17942963 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105194030 13:17948379-17948401 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105194149 13:17950249-17950271 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105194500 13:17955681-17955703 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105194622 13:17957551-17957573 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105194743 13:17959421-17959443 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105195110 13:17965037-17965059 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105195218 13:17966733-17966755 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105195337 13:17968603-17968625 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105195570 13:17972342-17972364 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105195804 13:17976086-17976108 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105195923 13:17977952-17977974 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105196046 13:17979823-17979845 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105196258 13:17983221-17983243 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105196381 13:17985083-17985105 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105196503 13:17986952-17986974 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105197293 13:17999354-17999376 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105197401 13:18001052-18001074 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105197521 13:18002922-18002944 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105197636 13:18004799-18004821 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105197751 13:18006671-18006693 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105197868 13:18008547-18008569 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105198101 13:18012120-18012142 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105198211 13:18013817-18013839 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105198329 13:18015687-18015709 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105198446 13:18017557-18017579 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105198566 13:18019431-18019453 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105198687 13:18021302-18021324 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105198807 13:18023175-18023197 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105198926 13:18025030-18025052 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105198992 13:18026050-18026072 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105199024 13:18026560-18026582 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105199137 13:18028430-18028452 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105199245 13:18030128-18030150 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105199360 13:18031827-18031849 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105199469 13:18033530-18033552 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105199710 13:18037270-18037292 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105199824 13:18038961-18038983 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105200523 13:18049840-18049862 TTAACGATATCGTTGGAAAAGGG + Intergenic
1105236539 13:18561028-18561050 TTATCTCCAAAGTTGGGGAAGGG - Intergenic
1105991346 13:25624952-25624974 TTATCTCTAAAGATATAAAATGG + Intronic
1106623789 13:31397859-31397881 TAATCTCCAATGTTGGAAATGGG + Intergenic
1107235408 13:38162583-38162605 TTATCTCTACCTTTAGGAAAGGG + Intergenic
1109003247 13:56834681-56834703 TAATCCCCAACGTTGGAAGAGGG - Intergenic
1109041961 13:57350215-57350237 ATATCTCTAACTTTGAAAATAGG + Intergenic
1110856930 13:80306832-80306854 TTATTTATAACGTTGGCAATTGG + Intergenic
1111671875 13:91341554-91341576 TAATCTCTAACGTTAGCCAAGGG - Intergenic
1112893186 13:104264475-104264497 TTATCTTTAACTTTATAAAATGG - Intergenic
1116411409 14:44627670-44627692 TTATCTCCACCATTGGATAACGG + Intergenic
1117943795 14:60996993-60997015 TACTCTCTAACTTTGGTAAAGGG - Intronic
1118976647 14:70683692-70683714 TTTTGTCTTACGTTGGATAAAGG - Intergenic
1121758979 14:96427524-96427546 TAATCTCCAATGTTGGAAGAGGG - Intronic
1122376059 14:101258527-101258549 TTCTCTTTAATGTTGGAAACAGG - Intergenic
1124795007 15:32769631-32769653 TTCTCTCTATAGCTGGAAAATGG + Exonic
1128219698 15:65959674-65959696 TTATTTATAACAGTGGAAAATGG + Intronic
1131155351 15:90071972-90071994 CTATCTCTAAAATTTGAAAAAGG - Intronic
1135528107 16:23229453-23229475 TTCCCTCCAACGTTGGAGAAGGG + Intergenic
1137914992 16:52420317-52420339 TTATGTGTAAAGTTGGAGAAGGG + Intergenic
1138947299 16:61867025-61867047 TTGTCTCTCACATTGGAAAAGGG - Intronic
1139043714 16:63031543-63031565 TGATCTCTACTGTTGGAAGATGG - Intergenic
1139190999 16:64862819-64862841 TTTTCTCAAAATTTGGAAAAAGG - Intergenic
1141857491 16:86693707-86693729 TTAGCTCTAACCAAGGAAAAAGG - Intergenic
1147486441 17:40819187-40819209 TTATCTCTAACGTTGGAAAACGG + Exonic
1147714189 17:42493169-42493191 TTCTGTCTAACCTTGGAACAGGG - Intronic
1152853857 17:82652661-82652683 TATTCTCTTACTTTGGAAAAAGG + Intergenic
1153654362 18:7269831-7269853 TTATCTCTAATGTTGGAGGTGGG - Intergenic
1154512994 18:15128888-15128910 TTATCTCCAAAGTTGGGGAAGGG + Intergenic
1155365946 18:25049244-25049266 TAATCTCTAACATTGGGGAAAGG - Intergenic
1155917250 18:31568863-31568885 TTATCTATACACTTGGAAAAAGG + Intergenic
1156033269 18:32738054-32738076 TTATTTGAAACATTGGAAAAAGG + Intronic
1156806843 18:41194399-41194421 TGATCTCTAATGTTGGAAGTTGG + Intergenic
1157650578 18:49325598-49325620 TTATATATAAAGTTTGAAAAAGG + Intronic
1158766850 18:60461082-60461104 TAATCTTTAACATTAGAAAATGG + Intergenic
1163725438 19:18920782-18920804 TCATCTCACACGTGGGAAAAGGG - Intronic
1165375002 19:35435609-35435631 TTGTCTCTAAAGAAGGAAAAAGG - Intergenic
1165969340 19:39613291-39613313 TAATCTCCAACGTTGGAGGAGGG + Intergenic
927102670 2:19799988-19800010 TTGTCTCTATCCTGGGAAAAAGG + Intergenic
927530269 2:23791332-23791354 TTATGTTTAACTTTGGAAAGTGG + Intronic
929702358 2:44174898-44174920 TTATCTCTGAGGTGGGGAAATGG + Intronic
932231309 2:70086664-70086686 TTGTTTCTAATGTCGGAAAAGGG + Intergenic
932879661 2:75489407-75489429 TAATCTCTAATGTTGGAGGACGG - Intronic
934140577 2:89043398-89043420 TTATCTGTCATGTTGGAATATGG - Intergenic
934228660 2:90157144-90157166 TTATCTGTCATGTTGGAATATGG + Intergenic
935611487 2:105030442-105030464 TTATCTCCAATGTTGGAAGTGGG + Intergenic
935798576 2:106669982-106670004 TAATCCCTAATGTTGGAAACGGG + Intergenic
936898098 2:117452009-117452031 TTATCTCCAATGTTGGAGACAGG + Intergenic
937393832 2:121517421-121517443 TTATCTCTTCCAGTGGAAAAAGG + Intronic
937686728 2:124706178-124706200 TTATTTCTAACATTTGGAAAGGG - Intronic
938513248 2:131973527-131973549 TTATCTCCAAAGTTGGGGAAGGG + Intergenic
940385131 2:153062552-153062574 TTTTCACTAAAGTTGGAAGATGG - Intergenic
940513994 2:154656591-154656613 TTATCTGTAAAATAGGAAAATGG - Intergenic
940519971 2:154733068-154733090 TTATCTCTAAGTTTGTAAAAAGG - Intronic
941690665 2:168498175-168498197 TTATCAATAACCTTAGAAAAGGG - Intronic
941879373 2:170465479-170465501 TGACCTCTAATGTTGGAAATGGG - Intronic
942382591 2:175407394-175407416 TTATCAATCATGTTGGAAAAAGG - Intergenic
944601322 2:201306348-201306370 TAATCTCCAATGTTGGAGAAGGG - Intronic
945108970 2:206344630-206344652 TAATCCCCAATGTTGGAAAAGGG + Intergenic
945314408 2:208356312-208356334 TTATGTAGAAAGTTGGAAAAGGG - Exonic
948576543 2:238955306-238955328 TTATTTGTAAAGTGGGAAAATGG - Intergenic
1176780529 21:13189314-13189336 TTATCTCCAAAGTTGGGGAAGGG - Intergenic
1179208983 21:39310073-39310095 TAATCACTGAAGTTGGAAAATGG + Intronic
1182180383 22:28340941-28340963 GTATCTTTAATGCTGGAAAAAGG - Intronic
1182225412 22:28794090-28794112 TCATCTGTAAAGTTGGATAATGG - Intergenic
1182641122 22:31768437-31768459 TTATCTCTCACTTTAGAAAATGG - Intronic
949593597 3:5519766-5519788 TGTTCTCTAACAATGGAAAATGG - Intergenic
949613246 3:5725953-5725975 TTATCTTTAACTTTGGACAGAGG + Intergenic
950160182 3:10754658-10754680 TGATCTCTAAAGTTGGAAGTGGG + Intergenic
952400409 3:32958119-32958141 TTCTCTCCAACTTTGGAATAAGG - Intergenic
957293527 3:78307397-78307419 TAATCCCTAATGTTGGAAGAGGG + Intergenic
957590833 3:82195750-82195772 TTATCTGTGATGTTGGAAATCGG + Intergenic
959761270 3:109968327-109968349 TTATCTGTTACATTTGAAAAAGG - Intergenic
960628798 3:119707387-119707409 TTTTCTCTAATGTTAGAGAAGGG - Exonic
962457321 3:135576708-135576730 TTACCTCACAAGTTGGAAAAGGG - Intergenic
963538473 3:146557792-146557814 TAATCTCTAATGTTGGAGATGGG + Intergenic
965140210 3:164823248-164823270 CAATCTCTATTGTTGGAAAAAGG - Intergenic
966392990 3:179472753-179472775 TTATGTCTTGAGTTGGAAAAGGG + Intergenic
966560328 3:181312643-181312665 CCATCTCCAACCTTGGAAAATGG - Intergenic
966663352 3:182440952-182440974 TTTTCTCTAACTTTGGGAAGGGG + Intergenic
967245140 3:187479027-187479049 TAATCTCCAATGTTGGAGAAGGG + Intergenic
972745365 4:41926921-41926943 TGAGCTCTAAAGTTGGAAAAGGG + Intergenic
974622264 4:64373630-64373652 TTATTTCTATTGTTGGAAAATGG - Intronic
975140876 4:70917071-70917093 TTACTTTTAACCTTGGAAAAAGG + Intronic
975259822 4:72285120-72285142 TTGTTTCTAACTTTAGAAAAAGG - Intronic
975831756 4:78376578-78376600 TTATCTCTACTGTGTGAAAAAGG - Intronic
975916637 4:79333077-79333099 TCTTCTCCCACGTTGGAAAAAGG - Intergenic
976162056 4:82212671-82212693 TTTTCTCACACGTTTGAAAATGG - Intergenic
976622290 4:87141399-87141421 TTTTCTTTAACGGTGGCAAAGGG - Intergenic
979802820 4:124932293-124932315 TTCTCTCTATGGTTGGAACATGG - Intergenic
979860512 4:125687358-125687380 TTATCCCCAACGTTAGAAATGGG - Intergenic
980363402 4:131766676-131766698 TTTTTTCTAACGTAGGAAGAAGG - Intergenic
980470354 4:133241447-133241469 TAATCTCTAAGGTGGGTAAAGGG + Intergenic
981426648 4:144611180-144611202 TAATCTCTAATGTTGGAGATGGG + Intergenic
982019211 4:151186764-151186786 ATATCTCTAACTCTAGAAAATGG + Intronic
982400416 4:154960923-154960945 TTATCTCTAGTGCTGAAAAATGG + Intergenic
988971426 5:36472187-36472209 TTATCTATAACATTTGAACAGGG + Intergenic
991762537 5:69933793-69933815 TTATCACAAACGTAGGACAACGG + Intergenic
991784788 5:70184313-70184335 TTATCACAAACGTAGGACAACGG - Intergenic
991841765 5:70808843-70808865 TTATCACAAACGTAGGACAACGG + Intergenic
991877236 5:71184706-71184728 TTATCACAAACGTAGGACAACGG - Intergenic
994627558 5:102240565-102240587 ATATCTGAAACATTGGAAAATGG + Intronic
995468295 5:112473839-112473861 TTATCTCAACCGTTAAAAAAAGG - Intergenic
995761598 5:115567609-115567631 TTATCTATTTCGTTGGAATATGG + Intergenic
1000209209 5:159095670-159095692 TTATCCCTAGGGTTGGAAATGGG + Exonic
1000850814 5:166338028-166338050 TTATCTCAAATGGGGGAAAAAGG - Intergenic
1001338077 5:170817657-170817679 TAATCTCCAATGTTGGAAGACGG + Intergenic
1001677745 5:173532439-173532461 TTTTCTCTAACCTTGAAATAGGG + Intergenic
1006001901 6:30971835-30971857 TAATCTCCAATGTTGGAAGAGGG - Intergenic
1008036496 6:46750731-46750753 ATATATATAAAGTTGGAAAAGGG + Intronic
1010854356 6:80819223-80819245 TTATCTCAAATCGTGGAAAAGGG + Intergenic
1011964012 6:93129941-93129963 TTATTTATAAGGTTGGAGAAAGG + Intergenic
1013019377 6:106197478-106197500 TTATCACCAAAGTTGGAAATGGG + Intronic
1014066147 6:117128476-117128498 TTATCTGTAACATTGAAAGAGGG + Intergenic
1020576329 7:9933708-9933730 TTATCTCAAACGGCGCAAAAAGG - Intergenic
1020965976 7:14868762-14868784 TTAACTATAATGTGGGAAAATGG + Intronic
1024834313 7:53497970-53497992 TTATCTCTATCGCTGCAAAAAGG - Intergenic
1030720229 7:112862363-112862385 TTAACTCTAACGTTATAATATGG - Intronic
1033245034 7:139710737-139710759 TGATCTCCAACGTTGGAGGAGGG + Intronic
1033402928 7:141044107-141044129 TTATCTATCACTTTGGAAATGGG - Intergenic
1034769417 7:153758587-153758609 TTATCTAAAATGTTAGAAAATGG - Intergenic
1034945125 7:155257090-155257112 TTATGTCTAACAGTGGGAAAAGG - Intergenic
1037565969 8:20118835-20118857 TAATCTCCAAAGTTGGAGAAGGG + Intergenic
1037750849 8:21681305-21681327 TCCTCTCCAACCTTGGAAAATGG - Intergenic
1039109963 8:34031184-34031206 TTATTTCACACGTTAGAAAATGG + Intergenic
1043324894 8:79037818-79037840 TTATCTCAAAAGATGAAAAAAGG + Intergenic
1044347701 8:91124897-91124919 TTATCTCTGGCTTAGGAAAAGGG - Intronic
1044806390 8:96012638-96012660 TTATCTCTTCCTTTGTAAAATGG + Intergenic
1044915834 8:97111980-97112002 TCATCTTTAACCCTGGAAAATGG + Intronic
1045923645 8:107562829-107562851 TTATCTCTCAGGCTGGAAAGAGG - Intergenic
1046579369 8:116072636-116072658 TTATTCCAAACTTTGGAAAAAGG - Intergenic
1048078634 8:131100791-131100813 TTATCTGTGACTTTGTAAAAAGG + Intergenic
1048596202 8:135868924-135868946 TTATCTTTACCCCTGGAAAAGGG - Intergenic
1050309894 9:4341822-4341844 TAATCAGTAACGTGGGAAAAAGG - Intronic
1050434251 9:5592394-5592416 CTATCACTAAGGTTGGAAAAAGG - Intergenic
1050851566 9:10293683-10293705 TTTTCCCAAACTTTGGAAAATGG - Intronic
1051024618 9:12593016-12593038 TGATATCTAATGTTGGAATAGGG - Intergenic
1051676452 9:19563342-19563364 TTATTTTTAAAGTTTGAAAATGG + Intronic
1051688044 9:19679250-19679272 TTATCTCTAAGGATGCATAAAGG + Intronic
1052179522 9:25506807-25506829 TAATCTCCAAGGTTGGAAGAGGG - Intergenic
1053083521 9:35197627-35197649 TAATCCCTAACGTTGGAGGAGGG + Intronic
1056449136 9:86698348-86698370 TTGTTTCTTTCGTTGGAAAATGG + Intergenic
1058066073 9:100549382-100549404 TAATCCCCAACGTTGGAAAAGGG - Intronic
1060886723 9:127159906-127159928 TCATCTCAAACTTTGAAAAAGGG + Intronic
1186488734 X:9954372-9954394 TTATCTCCAATGTTGGAAGAGGG - Intergenic
1187036368 X:15544542-15544564 TTCTCTGTAGCTTTGGAAAAGGG + Intronic
1188132833 X:26458718-26458740 TTATTTCTAAAGATAGAAAATGG - Intergenic
1190952749 X:55162204-55162226 TTATCTAAAAAGTTGGCAAAGGG + Intronic
1191576168 X:62708534-62708556 TTATCTGTAAGATTGGAAAAAGG - Intergenic
1193593783 X:83421576-83421598 TCATCCCTAATGTTGAAAAAGGG + Intergenic
1194920838 X:99761695-99761717 TTGTCTCTACCTTTGGAAAGGGG + Intergenic
1196083723 X:111661295-111661317 TAATCTCCAATGTTGGAAAAGGG + Intergenic
1196273355 X:113737750-113737772 TTATTTTTATTGTTGGAAAATGG + Intergenic
1196420681 X:115517575-115517597 TTATCTCTACTGGGGGAAAACGG - Intergenic
1196604969 X:117646580-117646602 TTATCACTACCTTAGGAAAATGG + Intergenic
1198885061 X:141326778-141326800 TTGTCTCTAACATTGGACAATGG + Intergenic
1199903767 X:152204184-152204206 TCATCTCTAAAGGTGAAAAATGG + Intronic
1201890954 Y:18943273-18943295 TTATCTCTAAAGGTGAGAAAAGG - Intergenic