ID: 1147486442

View in Genome Browser
Species Human (GRCh38)
Location 17:40819190-40819212
Sequence TCTCTAACGTTGGAAAACGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 41}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147486438_1147486442 11 Left 1147486438 17:40819156-40819178 CCGGAACTAAACGGGGTGAGGTC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1147486442 17:40819190-40819212 TCTCTAACGTTGGAAAACGGTGG 0: 1
1: 0
2: 0
3: 4
4: 41
1147486431_1147486442 20 Left 1147486431 17:40819147-40819169 CCGCCGCCTCCGGAACTAAACGG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1147486442 17:40819190-40819212 TCTCTAACGTTGGAAAACGGTGG 0: 1
1: 0
2: 0
3: 4
4: 41
1147486436_1147486442 14 Left 1147486436 17:40819153-40819175 CCTCCGGAACTAAACGGGGTGAG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1147486442 17:40819190-40819212 TCTCTAACGTTGGAAAACGGTGG 0: 1
1: 0
2: 0
3: 4
4: 41
1147486430_1147486442 26 Left 1147486430 17:40819141-40819163 CCGCGTCCGCCGCCTCCGGAACT 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1147486442 17:40819190-40819212 TCTCTAACGTTGGAAAACGGTGG 0: 1
1: 0
2: 0
3: 4
4: 41
1147486435_1147486442 17 Left 1147486435 17:40819150-40819172 CCGCCTCCGGAACTAAACGGGGT 0: 1
1: 0
2: 0
3: 2
4: 13
Right 1147486442 17:40819190-40819212 TCTCTAACGTTGGAAAACGGTGG 0: 1
1: 0
2: 0
3: 4
4: 41
1147486429_1147486442 29 Left 1147486429 17:40819138-40819160 CCGCCGCGTCCGCCGCCTCCGGA 0: 1
1: 1
2: 1
3: 52
4: 577
Right 1147486442 17:40819190-40819212 TCTCTAACGTTGGAAAACGGTGG 0: 1
1: 0
2: 0
3: 4
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147486442 Original CRISPR TCTCTAACGTTGGAAAACGG TGG Exonic
900235636 1:1588738-1588760 TCTCTGGGGTTGAAAAACGGGGG - Intergenic
909129939 1:71722281-71722303 TTTCTAAGGTTAGGAAACGGAGG - Intronic
915551163 1:156635333-156635355 TCTCTCAGGTGGGAAAACGGCGG - Intergenic
917328701 1:173860135-173860157 TATATAAAGTTGGAAAAGGGAGG + Intergenic
1065061353 10:21905098-21905120 TCTCTAAGGGTGGTAAAAGGAGG - Intronic
1080734708 11:35002168-35002190 TCGCTTAAGCTGGAAAACGGAGG - Intronic
1086888741 11:92231193-92231215 TCTCAAACATAGGAAAACAGAGG - Intergenic
1090092562 11:123711421-123711443 ACTCTAACTCTGCAAAACGGTGG - Intergenic
1091967144 12:4754446-4754468 CCTCTAACTTTGGAAAGAGGAGG - Intronic
1094159956 12:27379951-27379973 TCTCTAATATTGGAAACAGGTGG + Intronic
1095160239 12:38906274-38906296 TCTCCAACCTTGGAACACGGTGG + Intronic
1116820160 14:49620202-49620224 TCTCTAGAGCTGGAAAATGGAGG - Intronic
1138947298 16:61867022-61867044 TCTCTCACATTGGAAAAGGGAGG - Intronic
1140335624 16:74102546-74102568 TCTCTAAATGTGGAAAAGGGAGG + Intergenic
1142144482 16:88487219-88487241 TCTCGGACCTTGGAAAATGGGGG - Intronic
1147486442 17:40819190-40819212 TCTCTAACGTTGGAAAACGGTGG + Exonic
931989860 2:67779194-67779216 CCTCTGACTTTGGAAAAGGGAGG + Intergenic
935300821 2:101692579-101692601 TCTCACATGTTAGAAAACGGAGG + Intergenic
936490641 2:112969096-112969118 TCTCTACCACTGGAAAACTGAGG - Intergenic
947389764 2:229626963-229626985 TCAATCACGTTGGAAAACTGAGG + Intronic
1170993960 20:21333811-21333833 TCTCTAACGATGGCAAATGAGGG - Exonic
1173956330 20:47035755-47035777 CCTGTAACTTTGGGAAACGGAGG + Intronic
1175502043 20:59457343-59457365 TCTCACAGGTTGGAAAACTGAGG + Intergenic
1176219558 20:63963521-63963543 TTTCTAACCTCGGACAACGGTGG - Intronic
1182146071 22:27997577-27997599 TCTCAAACTTTGGGAAACAGAGG - Intronic
954491655 3:50912678-50912700 TCTCTGCCTTTGGAAAAGGGAGG - Intronic
960628797 3:119707384-119707406 TCTCTAATGTTAGAGAAGGGAGG - Exonic
973811282 4:54572547-54572569 TCTCTAAGGTTGGAAATGGTAGG - Intergenic
975905603 4:79208161-79208183 GCTCTAACTTTGGAATAAGGTGG + Intergenic
994235558 5:97358341-97358363 TCTCTGACTTTGGAAAGGGGAGG - Intergenic
1004144585 6:13053271-13053293 TCTGTAACCATGGAAAACGTTGG + Intronic
1004234567 6:13862663-13862685 CCTCTAAGATTGGAAATCGGGGG - Intergenic
1008017914 6:46541915-46541937 CCTCTACCTTTGGAAAAGGGAGG + Intergenic
1008036497 6:46750734-46750756 TATATAAAGTTGGAAAAGGGAGG + Intronic
1012766509 6:103373548-103373570 TTTATAACTTTGGAAAACTGTGG + Intergenic
1015861930 6:137690488-137690510 TTGCTAATGTTGGAAAACGTGGG - Intergenic
1022102854 7:27179491-27179513 TCCCTAAGGTTGGAAAGCAGGGG - Intronic
1027416446 7:77979557-77979579 TCTCAAAGGTGGGAAAACTGTGG - Intergenic
1030876494 7:114819891-114819913 TCTGTAAGGTAGGAAAAGGGCGG - Intergenic
1031325887 7:120396586-120396608 CTACTAACGTTGGAAAACAGAGG + Intronic
1033495798 7:141894220-141894242 TATGTAACTTTGGAAAACAGTGG + Intergenic
1036421972 8:8605109-8605131 TCTCTCAGGCTGGAAAACAGCGG - Intergenic
1041622749 8:59990910-59990932 TCCCTAAGATTGGGAAACGGGGG + Intergenic
1187367419 X:18676304-18676326 TCTTCCACGTAGGAAAACGGAGG + Intronic
1198885062 X:141326781-141326803 TCTCTAACATTGGACAATGGTGG + Intergenic
1199050633 X:143232687-143232709 CCTCTAATTTTGGAAAAGGGAGG + Intergenic